EMAIL THIS PAGE TO A FRIEND

MIA

melanoma inhibitory activity

58 Gene Product Result for
Synonyms: CD-RAP
UniProtKB ID: Q16674, Q6FHV3
Gene ID:
Mouse(12587) melanoma inhibitory activity
Rat(81510) melanoma inhibitory activity
fruit fly(40667) meiosis I arrest
dog(484496) melanoma inhibitory activity
domestic cat(101090568) melanoma inhibitory activity
Horse(100064799) melanoma inhibitory activity
cow(280857) melanoma inhibitory activity
sheep(101121033) melanoma inhibitory activity
naked mole-rat(101700800) melanoma inhibitory activity
domestic guinea pig(100726341) melanoma inhibitory activity
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1583 Human MIA ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006533 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU000161 MISSION® esiRNA esiRNA targeting mouse Mia1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006533 Rosetta Predictions human pricing
NM_030852 Rosetta Predictions rat pricing
NM_019394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159073 predicted 321
2 SASI_Hs01_00159074 predicted 342
3 SASI_Hs02_00341778 predicted 227
4 SASI_Hs02_00341779 predicted 246
5 SASI_Hs01_00159076 predicted 351
6 SASI_Hs01_00159077 predicted 312
7 SASI_Hs01_00159078 predicted 375
8 SASI_Hs02_00341780 predicted 241
9 SASI_Hs01_00159080 predicted 275
10 SASI_Hs02_00341781 predicted 272
11 SASI_Hs01_00159075 predicted 296
12 SASI_Hs01_00159079 predicted 242
13 SASI_Hs01_00159081 predicted 281
14 SASI_Hs01_00159082 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030852 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053730 predicted 261
2 SASI_Rn02_00264095 predicted 255
3 SASI_Rn01_00053732 predicted 208
4 SASI_Rn01_00053733 predicted 261
5 SASI_Rn01_00053734 predicted 266
6 SASI_Rn01_00053735 predicted 209
7 SASI_Rn01_00053736 predicted 210
8 SASI_Rn01_00053738 predicted 203
9 SASI_Rn01_00053739 predicted 295
10 SASI_Rn02_00264096 predicted 210
11 SASI_Rn01_00053731 predicted 277
12 SASI_Rn01_00053737 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195757 predicted 263
2 SASI_Mm01_00195758 predicted 268
3 SASI_Mm01_00195759 predicted 272
4 SASI_Mm01_00195760 predicted 295
5 SASI_Mm01_00195761 predicted 267
6 SASI_Mm01_00195763 predicted 212
7 SASI_Mm01_00195764 predicted 300
8 SASI_Mm01_00195765 predicted 267
9 SASI_Mm01_00195766 predicted 305
10 SASI_Mm02_00324316 predicted 265
11 SASI_Mm01_00195762 predicted 237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006533
MIA MISSION shRNA Bacterial Glycerol Stock
melanoma inhibitory activity
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-279s1c1
Sequence:CCGGGTGTATGTCTTCTCCAAGCTGCTCGAGCAGCTTGGAGAAGACATACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-331s1c1
Sequence:CCGGGCGTTCAGGGAGATTACTATGCTCGAGCATAGTAATCTCCCTGAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-336s1c1
Sequence:CCGGCAGGGAGATTACTATGGAGATCTCGAGATCTCCATAGTAATCTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-342s1c1
Sequence:CCGGGATTACTATGGAGATCTGGCTCTCGAGAGCCAGATCTCCATAGTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-333s1c1
Sequence:CCGGGTTCAGGGAGATTACTATGGACTCGAGTCCATAGTAATCTCCCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-281s1c1
Sequence:CCGGGTATGTCTTCTCCAAGCTGAACTCGAGTTCAGCTTGGAGAAGACATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-272s1c1
Sequence:CCGGCCAAGTGGTGTATGTCTTCTCCTCGAGGAGAAGACATACACCACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006533.2-174s21c1
Sequence:CCGGGTGTCATCATCTTGCTGTCTGCTCGAGCAGACAGCAAGATGATGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006533.2-323s21c1
Sequence:CCGGTGCCGATTCCTGACCATTCACCTCGAGGTGAATGGTCAGGAATCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006533.2-292s21c1
Sequence:CCGGTGTGGCCCTTCAGGACTACATCTCGAGATGTAGTCCTGAAGGGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006533
MIA MISSION shRNA shRNA Plasmid DNA
melanoma inhibitory activity
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-279s1c1
Sequence:CCGGGTGTATGTCTTCTCCAAGCTGCTCGAGCAGCTTGGAGAAGACATACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-331s1c1
Sequence:CCGGGCGTTCAGGGAGATTACTATGCTCGAGCATAGTAATCTCCCTGAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-336s1c1
Sequence:CCGGCAGGGAGATTACTATGGAGATCTCGAGATCTCCATAGTAATCTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-342s1c1
Sequence:CCGGGATTACTATGGAGATCTGGCTCTCGAGAGCCAGATCTCCATAGTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-333s1c1
Sequence:CCGGGTTCAGGGAGATTACTATGGACTCGAGTCCATAGTAATCTCCCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-281s1c1
Sequence:CCGGGTATGTCTTCTCCAAGCTGAACTCGAGTTCAGCTTGGAGAAGACATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-272s1c1
Sequence:CCGGCCAAGTGGTGTATGTCTTCTCCTCGAGGAGAAGACATACACCACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006533.2-174s21c1
Sequence:CCGGGTGTCATCATCTTGCTGTCTGCTCGAGCAGACAGCAAGATGATGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006533.2-323s21c1
Sequence:CCGGTGCCGATTCCTGACCATTCACCTCGAGGTGAATGGTCAGGAATCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006533.2-292s21c1
Sequence:CCGGTGTGGCCCTTCAGGACTACATCTCGAGATGTAGTCCTGAAGGGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006533
MIA MISSION shRNA Lentiviral Transduction Particles
melanoma inhibitory activity
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-279s1c1
Sequence:CCGGGTGTATGTCTTCTCCAAGCTGCTCGAGCAGCTTGGAGAAGACATACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-331s1c1
Sequence:CCGGGCGTTCAGGGAGATTACTATGCTCGAGCATAGTAATCTCCCTGAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-336s1c1
Sequence:CCGGCAGGGAGATTACTATGGAGATCTCGAGATCTCCATAGTAATCTCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-342s1c1
Sequence:CCGGGATTACTATGGAGATCTGGCTCTCGAGAGCCAGATCTCCATAGTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-333s1c1
Sequence:CCGGGTTCAGGGAGATTACTATGGACTCGAGTCCATAGTAATCTCCCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-281s1c1
Sequence:CCGGGTATGTCTTCTCCAAGCTGAACTCGAGTTCAGCTTGGAGAAGACATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006533.1-272s1c1
Sequence:CCGGCCAAGTGGTGTATGTCTTCTCCTCGAGGAGAAGACATACACCACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006533.2-174s21c1
Sequence:CCGGGTGTCATCATCTTGCTGTCTGCTCGAGCAGACAGCAAGATGATGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006533.2-323s21c1
Sequence:CCGGTGCCGATTCCTGACCATTCACCTCGAGGTGAATGGTCAGGAATCGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006533.2-292s21c1
Sequence:CCGGTGTGGCCCTTCAGGACTACATCTCGAGATGTAGTCCTGAAGGGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019394
MIA MISSION shRNA Bacterial Glycerol Stock
melanoma inhibitory activity
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019394.1-282s1c1
Sequence:CCGGGCCGCTTCTTGACTATATATACTCGAGTATATATAGTCAAGAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019394.1-215s1c1
Sequence:CCGGGCGGACGAGGAATGCAGCCATCTCGAGATGGCTGCATTCCTCGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019394.1-360s1c1
Sequence:CCGGGAGGCAGTGTTCAGGGAGGTTCTCGAGAACCTCCCTGAACACTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019394.1-175s1c1
Sequence:CCGGTGATCGAGCTATGCCCAAGCTCTCGAGAGCTTGGGCATAGCTCGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019394.1-278s1c1
Sequence:CCGGGATTGCCGCTTCTTGACTATACTCGAGTATAGTCAAGAAGCGGCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019394.3-130s21c1
Sequence:CCGGGCATCGTCGTCTTGTCTGTTTCTCGAGAAACAGACAAGACGACGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019394.3-458s21c1
Sequence:CCGGTGATATGAAGACCGATCAATGCTCGAGCATTGATCGGTCTTCATATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019394
MIA MISSION shRNA shRNA Plasmid DNA
melanoma inhibitory activity
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019394.1-282s1c1
Sequence:CCGGGCCGCTTCTTGACTATATATACTCGAGTATATATAGTCAAGAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019394.1-215s1c1
Sequence:CCGGGCGGACGAGGAATGCAGCCATCTCGAGATGGCTGCATTCCTCGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019394.1-360s1c1
Sequence:CCGGGAGGCAGTGTTCAGGGAGGTTCTCGAGAACCTCCCTGAACACTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019394.1-175s1c1
Sequence:CCGGTGATCGAGCTATGCCCAAGCTCTCGAGAGCTTGGGCATAGCTCGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019394.1-278s1c1
Sequence:CCGGGATTGCCGCTTCTTGACTATACTCGAGTATAGTCAAGAAGCGGCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019394.3-130s21c1
Sequence:CCGGGCATCGTCGTCTTGTCTGTTTCTCGAGAAACAGACAAGACGACGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019394.3-458s21c1
Sequence:CCGGTGATATGAAGACCGATCAATGCTCGAGCATTGATCGGTCTTCATATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019394
MIA MISSION shRNA Lentiviral Transduction Particles
melanoma inhibitory activity
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019394.1-282s1c1
Sequence:CCGGGCCGCTTCTTGACTATATATACTCGAGTATATATAGTCAAGAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019394.1-215s1c1
Sequence:CCGGGCGGACGAGGAATGCAGCCATCTCGAGATGGCTGCATTCCTCGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019394.1-360s1c1
Sequence:CCGGGAGGCAGTGTTCAGGGAGGTTCTCGAGAACCTCCCTGAACACTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019394.1-175s1c1
Sequence:CCGGTGATCGAGCTATGCCCAAGCTCTCGAGAGCTTGGGCATAGCTCGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019394.1-278s1c1
Sequence:CCGGGATTGCCGCTTCTTGACTATACTCGAGTATAGTCAAGAAGCGGCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019394.3-130s21c1
Sequence:CCGGGCATCGTCGTCTTGTCTGTTTCTCGAGAAACAGACAAGACGACGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019394.3-458s21c1
Sequence:CCGGTGATATGAAGACCGATCAATGCTCGAGCATTGATCGGTCTTCATATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)