EMAIL THIS PAGE TO A FRIEND

MIB1

mindbomb E3 ubiquitin protein ligase 1

247 Gene Product Result for
Synonyms: DIP-1 DIP1 LVNC7 MIB ZZANK2 ZZZ6
Gene ID:
Human(57534) Summary: This gene encodes a protein containing multiple ankyrin repeats and RING finger domains that functions as an E3 ubiquitin ligase. The encoded protein positively regulates Notch signaling by ubiquitinating the Notch receptors, thereby facilitating their endocytosis. This protein may also promote the ubiquitination and degradation of death-associated protein kinase 1 (DAPK1). [provided by RefSeq, Jun 2013]
Mouse(225164) mindbomb homolog 1 (Drosophila)
Rat(307594) mindbomb E3 ubiquitin protein ligase 1
fruit fly(39750) mind bomb 1
chicken(421069) mindbomb E3 ubiquitin protein ligase 1
dog(490521) mindbomb E3 ubiquitin protein ligase 1
cow(533735) mindbomb homolog 1 (Drosophila)
Horse(100060229) mindbomb E3 ubiquitin protein ligase 1
domestic cat(101095523) mindbomb E3 ubiquitin protein ligase 1
sheep(101122068) mindbomb E3 ubiquitin protein ligase 1
Domestic Rabbit(100352922) mindbomb E3 ubiquitin protein ligase 1
naked mole-rat(101715944) mindbomb E3 ubiquitin protein ligase 1
domestic guinea pig(100721079) mindbomb E3 ubiquitin protein ligase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020774 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020774 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020774 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144860 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144860 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144860 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033791 MISSION® esiRNA esiRNA human MIB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020774 Rosetta Predictions human pricing
NM_001107405 Rosetta Predictions rat pricing
NM_144860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035165 predicted 401
2 SASI_Hs02_00353911 predicted 1414
3 SASI_Hs02_00353912 predicted 1133
4 SASI_Hs02_00353913 predicted 2783
5 SASI_Hs01_00035166 predicted 1888
6 SASI_Hs01_00035167 predicted 733
7 SASI_Hs01_00035168 predicted 372
8 SASI_Hs01_00035170 predicted 2107
9 SASI_Hs01_00035172 predicted 288
10 SASI_Hs01_00035173 predicted 569
11 SASI_Hs01_00035169 predicted 1524
12 SASI_Hs01_00035171 predicted 1066
13 SASI_Hs01_00035174 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228495 predicted 1439
2 SASI_Rn02_00228496 predicted 1413
3 SASI_Rn02_00228497 predicted 1280
4 SASI_Rn02_00228498 predicted 1024
5 SASI_Rn02_00228499 predicted 913
6 SASI_Rn02_00228500 predicted 3216
7 SASI_Rn02_00228501 predicted 1250
8 SASI_Rn02_00228502 predicted 2076
9 SASI_Rn02_00228503 predicted 2764
10 SASI_Rn02_00228504 predicted 2552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030590 predicted 1413
2 SASI_Mm01_00030591 predicted 1249
3 SASI_Mm01_00030592 predicted 3146
4 SASI_Mm01_00030594 predicted 923
5 SASI_Mm02_00340285 predicted 1814
6 SASI_Mm02_00340286 predicted 2556
7 SASI_Mm01_00030596 predicted 957
8 SASI_Mm01_00030598 predicted 1464
9 SASI_Mm01_00030599 predicted 948
10 SASI_Mm02_00340287 predicted 3092
11 SASI_Mm01_00030593 predicted 3217
12 SASI_Mm01_00030595 predicted 2801
13 SASI_Mm01_00030597 predicted 1453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020774
VALIDATED
MIB1 MISSION shRNA Bacterial Glycerol Stock
mindbomb E3 ubiquitin protein ligase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020774.2-585s21c1
Sequence:CCGGCCTCTGGGATAATGGTGCTAACTCGAGTTAGCACCATTATCCCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020774.2-1475s21c1
Sequence:CCGGCAGAGGATAAAGATGGTGATACTCGAGTATCACCATCTTTATCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020774.2-1109s21c1
Sequence:CCGGGCCGAGTACAACAGATTTATTCTCGAGAATAAATCTGTTGTACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_020774.x-1475s1c1
Sequence:CCGGCAGAGGATAAAGATGGTGATACTCGAGTATCACCATCTTTATCCTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_020774.x-2811s1c1
Sequence:CCGGCAAGGATAATACCAATGTCAACTCGAGTTGACATTGGTATTATCCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020774.x-1109s1c1
Sequence:CCGGGCCGAGTACAACAGATTTATTCTCGAGAATAAATCTGTTGTACTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020774.x-585s1c1
Sequence:CCGGCCTCTGGGATAATGGTGCTAACTCGAGTTAGCACCATTATCCCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020774.2-2811s21c1
Sequence:CCGGCAAGGATAATACCAATGTCAACTCGAGTTGACATTGGTATTATCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020774.x-1708s1c1
Sequence:CCGGGCAATAAGTAAGAAACGTGATCTCGAGATCACGTTTCTTACTTATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020774
VALIDATED
MIB1 MISSION shRNA shRNA Plasmid DNA
mindbomb E3 ubiquitin protein ligase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020774.2-585s21c1
Sequence:CCGGCCTCTGGGATAATGGTGCTAACTCGAGTTAGCACCATTATCCCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020774.2-1475s21c1
Sequence:CCGGCAGAGGATAAAGATGGTGATACTCGAGTATCACCATCTTTATCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020774.2-1109s21c1
Sequence:CCGGGCCGAGTACAACAGATTTATTCTCGAGAATAAATCTGTTGTACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_020774.x-1475s1c1
Sequence:CCGGCAGAGGATAAAGATGGTGATACTCGAGTATCACCATCTTTATCCTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_020774.x-2811s1c1
Sequence:CCGGCAAGGATAATACCAATGTCAACTCGAGTTGACATTGGTATTATCCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020774.x-1109s1c1
Sequence:CCGGGCCGAGTACAACAGATTTATTCTCGAGAATAAATCTGTTGTACTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020774.x-585s1c1
Sequence:CCGGCCTCTGGGATAATGGTGCTAACTCGAGTTAGCACCATTATCCCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020774.2-2811s21c1
Sequence:CCGGCAAGGATAATACCAATGTCAACTCGAGTTGACATTGGTATTATCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020774.x-1708s1c1
Sequence:CCGGGCAATAAGTAAGAAACGTGATCTCGAGATCACGTTTCTTACTTATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020774
VALIDATED
MIB1 MISSION shRNA Lentiviral Transduction Particles
mindbomb E3 ubiquitin protein ligase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020774.2-585s21c1
Sequence:CCGGCCTCTGGGATAATGGTGCTAACTCGAGTTAGCACCATTATCCCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020774.2-1475s21c1
Sequence:CCGGCAGAGGATAAAGATGGTGATACTCGAGTATCACCATCTTTATCCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020774.2-1109s21c1
Sequence:CCGGGCCGAGTACAACAGATTTATTCTCGAGAATAAATCTGTTGTACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_020774.x-1475s1c1
Sequence:CCGGCAGAGGATAAAGATGGTGATACTCGAGTATCACCATCTTTATCCTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_020774.x-2811s1c1
Sequence:CCGGCAAGGATAATACCAATGTCAACTCGAGTTGACATTGGTATTATCCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020774.x-1109s1c1
Sequence:CCGGGCCGAGTACAACAGATTTATTCTCGAGAATAAATCTGTTGTACTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020774.x-585s1c1
Sequence:CCGGCCTCTGGGATAATGGTGCTAACTCGAGTTAGCACCATTATCCCAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020774.2-2811s21c1
Sequence:CCGGCAAGGATAATACCAATGTCAACTCGAGTTGACATTGGTATTATCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020774.x-1708s1c1
Sequence:CCGGGCAATAAGTAAGAAACGTGATCTCGAGATCACGTTTCTTACTTATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144860
MIB1 MISSION shRNA Bacterial Glycerol Stock
mindbomb E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144860.2-3096s1c1
Sequence:CCGGCCTTCTATGATTAGCAACGATCTCGAGATCGTTGCTAATCATAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144860.2-2241s1c1
Sequence:CCGGGCTGACCTGAATGCTCGTAATCTCGAGATTACGAGCATTCAGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144860.2-3642s1c1
Sequence:CCGGCGGATGAGTGAATGCCCAATTCTCGAGAATTGGGCATTCACTCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144860.2-1496s1c1
Sequence:CCGGCGATGGCATGTTTGAGACTTTCTCGAGAAAGTCTCAAACATGCCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144860.2-2388s1c1
Sequence:CCGGGCCATAAGTAAGAAACGGGATCTCGAGATCCCGTTTCTTACTTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144860
MIB1 MISSION shRNA shRNA Plasmid DNA
mindbomb E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144860.2-3096s1c1
Sequence:CCGGCCTTCTATGATTAGCAACGATCTCGAGATCGTTGCTAATCATAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144860.2-2241s1c1
Sequence:CCGGGCTGACCTGAATGCTCGTAATCTCGAGATTACGAGCATTCAGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144860.2-3642s1c1
Sequence:CCGGCGGATGAGTGAATGCCCAATTCTCGAGAATTGGGCATTCACTCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144860.2-1496s1c1
Sequence:CCGGCGATGGCATGTTTGAGACTTTCTCGAGAAAGTCTCAAACATGCCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144860.2-2388s1c1
Sequence:CCGGGCCATAAGTAAGAAACGGGATCTCGAGATCCCGTTTCTTACTTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144860
MIB1 MISSION shRNA Lentiviral Transduction Particles
mindbomb E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144860.2-3096s1c1
Sequence:CCGGCCTTCTATGATTAGCAACGATCTCGAGATCGTTGCTAATCATAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144860.2-2241s1c1
Sequence:CCGGGCTGACCTGAATGCTCGTAATCTCGAGATTACGAGCATTCAGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144860.2-3642s1c1
Sequence:CCGGCGGATGAGTGAATGCCCAATTCTCGAGAATTGGGCATTCACTCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144860.2-1496s1c1
Sequence:CCGGCGATGGCATGTTTGAGACTTTCTCGAGAAAGTCTCAAACATGCCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144860.2-2388s1c1
Sequence:CCGGGCCATAAGTAAGAAACGGGATCTCGAGATCCCGTTTCTTACTTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)