EMAIL THIS PAGE TO A FRIEND

MIB2

mindbomb E3 ubiquitin protein ligase 2

63 Gene Product Result for
Synonyms: ZZANK1 ZZZ5
Gene ID:
Mouse(76580) mindbomb homolog 2 (Drosophila)
Rat(474147) mindbomb E3 ubiquitin protein ligase 2
domestic guinea pig(100727066) mindbomb E3 ubiquitin protein ligase 2
naked mole-rat(101706587) mindbomb E3 ubiquitin protein ligase 2
sheep(101102748) mindbomb E3 ubiquitin protein ligase 2
Zebrafish(560887) mind bomb 2
fruit fly(35170) mind bomb 2
cow(538270) mindbomb E3 ubiquitin protein ligase 2
domestic cat(101087306) mindbomb E3 ubiquitin protein ligase 2
dog(479566) mindbomb E3 ubiquitin protein ligase 2
chicken(419408) mindbomb E3 ubiquitin protein ligase 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080875 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145124 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145124 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145124 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU081561 MISSION® esiRNA esiRNA targeting mouse Mib2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080875 Rosetta Predictions human pricing
XM_001052967 Rosetta Predictions rat pricing
XM_001052968 Rosetta Predictions rat pricing
NM_145124 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031059 predicted 1436
2 SASI_Hs01_00031060 predicted 616
3 SASI_Hs01_00031062 predicted 906
4 SASI_Hs01_00031063 predicted 1385
5 SASI_Hs01_00031064 predicted 1737
6 SASI_Hs01_00031065 predicted 989
7 SASI_Hs01_00031066 predicted 1542
8 SASI_Hs01_00031067 predicted 940
9 SASI_Hs01_00031068 predicted 1104
10 SASI_Hs02_00362672 predicted 1302
11 SASI_Hs01_00031061 predicted 1791
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270814 predicted 274
2 SASI_Rn02_00270815 predicted 279
3 SASI_Rn02_00270816 predicted 223
4 SASI_Rn02_00270817 predicted 277
5 SASI_Rn02_00270818 predicted 205
6 SASI_Rn02_00270819 predicted 374
7 SASI_Rn02_00270820 predicted 370
8 SASI_Rn02_00270821 predicted 453
9 SASI_Rn02_00270822 predicted 317
10 SASI_Rn02_00270823 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052968 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270824 predicted 281
2 SASI_Rn02_00270825 predicted 277
3 SASI_Rn02_00270826 predicted 221
4 SASI_Rn02_00270827 predicted 276
5 SASI_Rn02_00270828 predicted 206
6 SASI_Rn02_00270829 predicted 374
7 SASI_Rn02_00270830 predicted 371
8 SASI_Rn02_00270831 predicted 453
9 SASI_Rn02_00270832 predicted 316
10 SASI_Rn02_00270833 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172739 predicted 1631
2 SASI_Mm01_00172740 predicted 2186
3 SASI_Mm01_00172741 predicted 2609
4 SASI_Mm01_00172744 predicted 3250
5 SASI_Mm02_00340508 predicted 3005
6 SASI_Mm01_00172742 predicted 2138
7 SASI_Mm01_00172745 predicted 1018
8 SASI_Mm02_00340509 predicted 3161
9 SASI_Mm02_00340510 predicted 2697
10 SASI_Mm01_00172746 predicted 1713
11 SASI_Mm01_00172743 predicted 1030
12 SASI_Mm01_00172747 predicted 1046
13 SASI_Mm01_00172748 predicted 2510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080875
VALIDATED
MIB2 MISSION shRNA Bacterial Glycerol Stock
mindbomb E3 ubiquitin protein ligase 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_080875.1-649s1c1
Sequence:CCGGGCAGTGCTACATGCACAACAACTCGAGTTGTTGTGCATGTAGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080875.1-159s1c1
Sequence:CCGGAGTCCCAAAGTTTCCAGGCATCTCGAGATGCCTGGAAACTTTGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_080875.1-2138s1c1
Sequence:CCGGGCGCTAGCTGTGAGAAAGATTCTCGAGAATCTTTCTCACAGCTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_080875.1-2060s1c1
Sequence:CCGGGAGGTGCCAAACATCGATGTTCTCGAGAACATCGATGTTTGGCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080875.1-1405s1c1
Sequence:CCGGGAAAGTGTTTGGAGACGGGAACTCGAGTTCCCGTCTCCAAACACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-2990s21c1
Sequence:CCGGAGGTGGTCGTCAGCAAGAAACCTCGAGGTTTCTTGCTGACGACCACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-858s21c1
Sequence:CCGGCATCTTCCAGGGAGCGAAGGTCTCGAGACCTTCGCTCCCTGGAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-2304s21c1
Sequence:CCGGGCATCTGGCTGCCCTCAACAACTCGAGTTGTTGAGGGCAGCCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-713s21c1
Sequence:CCGGTGTGCCTGGACTACGACCTCTCTCGAGAGAGGTCGTAGTCCAGGCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-2673s21c1
Sequence:CCGGCGACGTGAGCTACACCAACCACTCGAGTGGTTGGTGTAGCTCACGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-2966s21c1
Sequence:CCGGGGATGAAGAAGTGCATCAGGTCTCGAGACCTGATGCACTTCTTCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-606s21c1
Sequence:CCGGCGACCTGCTGCTGTACGACAACTCGAGTTGTCGTACAGCAGCAGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-1170s21c1
Sequence:CCGGGGACAAGGTCAAGTGTCTGCTCTCGAGAGCAGACACTTGACCTTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080875
VALIDATED
MIB2 MISSION shRNA shRNA Plasmid DNA
mindbomb E3 ubiquitin protein ligase 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_080875.1-649s1c1
Sequence:CCGGGCAGTGCTACATGCACAACAACTCGAGTTGTTGTGCATGTAGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080875.1-159s1c1
Sequence:CCGGAGTCCCAAAGTTTCCAGGCATCTCGAGATGCCTGGAAACTTTGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_080875.1-2138s1c1
Sequence:CCGGGCGCTAGCTGTGAGAAAGATTCTCGAGAATCTTTCTCACAGCTAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_080875.1-2060s1c1
Sequence:CCGGGAGGTGCCAAACATCGATGTTCTCGAGAACATCGATGTTTGGCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080875.1-1405s1c1
Sequence:CCGGGAAAGTGTTTGGAGACGGGAACTCGAGTTCCCGTCTCCAAACACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-2990s21c1
Sequence:CCGGAGGTGGTCGTCAGCAAGAAACCTCGAGGTTTCTTGCTGACGACCACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-858s21c1
Sequence:CCGGCATCTTCCAGGGAGCGAAGGTCTCGAGACCTTCGCTCCCTGGAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-2304s21c1
Sequence:CCGGGCATCTGGCTGCCCTCAACAACTCGAGTTGTTGAGGGCAGCCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-713s21c1
Sequence:CCGGTGTGCCTGGACTACGACCTCTCTCGAGAGAGGTCGTAGTCCAGGCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-2673s21c1
Sequence:CCGGCGACGTGAGCTACACCAACCACTCGAGTGGTTGGTGTAGCTCACGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-2966s21c1
Sequence:CCGGGGATGAAGAAGTGCATCAGGTCTCGAGACCTGATGCACTTCTTCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-606s21c1
Sequence:CCGGCGACCTGCTGCTGTACGACAACTCGAGTTGTCGTACAGCAGCAGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-1170s21c1
Sequence:CCGGGGACAAGGTCAAGTGTCTGCTCTCGAGAGCAGACACTTGACCTTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080875
VALIDATED
MIB2 MISSION shRNA Lentiviral Transduction Particles
mindbomb E3 ubiquitin protein ligase 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_080875.1-649s1c1
Sequence:CCGGGCAGTGCTACATGCACAACAACTCGAGTTGTTGTGCATGTAGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080875.1-159s1c1
Sequence:CCGGAGTCCCAAAGTTTCCAGGCATCTCGAGATGCCTGGAAACTTTGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_080875.1-2138s1c1
Sequence:CCGGGCGCTAGCTGTGAGAAAGATTCTCGAGAATCTTTCTCACAGCTAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_080875.1-2060s1c1
Sequence:CCGGGAGGTGCCAAACATCGATGTTCTCGAGAACATCGATGTTTGGCACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080875.1-1405s1c1
Sequence:CCGGGAAAGTGTTTGGAGACGGGAACTCGAGTTCCCGTCTCCAAACACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-2990s21c1
Sequence:CCGGAGGTGGTCGTCAGCAAGAAACCTCGAGGTTTCTTGCTGACGACCACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-858s21c1
Sequence:CCGGCATCTTCCAGGGAGCGAAGGTCTCGAGACCTTCGCTCCCTGGAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-2304s21c1
Sequence:CCGGGCATCTGGCTGCCCTCAACAACTCGAGTTGTTGAGGGCAGCCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-713s21c1
Sequence:CCGGTGTGCCTGGACTACGACCTCTCTCGAGAGAGGTCGTAGTCCAGGCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-2673s21c1
Sequence:CCGGCGACGTGAGCTACACCAACCACTCGAGTGGTTGGTGTAGCTCACGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-2966s21c1
Sequence:CCGGGGATGAAGAAGTGCATCAGGTCTCGAGACCTGATGCACTTCTTCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-606s21c1
Sequence:CCGGCGACCTGCTGCTGTACGACAACTCGAGTTGTCGTACAGCAGCAGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080875.2-1170s21c1
Sequence:CCGGGGACAAGGTCAAGTGTCTGCTCTCGAGAGCAGACACTTGACCTTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145124
VALIDATED
MIB2 MISSION shRNA Bacterial Glycerol Stock
mindbomb E3 ubiquitin protein ligase 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145124.1-2893s1c1
Sequence:CCGGTCGAAGGATGAAGAAGTGTATCTCGAGATACACTTCTTCATCCTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145124.1-1412s1c1
Sequence:CCGGGTGGTGAAGGTGTTTGGAGATCTCGAGATCTCCAAACACCTTCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145124.1-646s1c1
Sequence:CCGGGCTCTATGACAACGCCCAAATCTCGAGATTTGGGCGTTGTCATAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145124.1-814s1c1
Sequence:CCGGGCGCTATGAGACATCTCACTTCTCGAGAAGTGAGATGTCTCATAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145124.1-2592s1c1
Sequence:CCGGGTGCTGATGTGACTACGCAAACTCGAGTTTGCGTAGTCACATCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145124.2-3359s21c1
Sequence:CCGGGACGGCTCAGAGGTGGTAAATCTCGAGATTTACCACCTCTGAGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145124.2-3236s21c1
Sequence:CCGGTCGGAGCTGGCATTGCTAATTCTCGAGAATTAGCAATGCCAGCTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145124.2-3619s21c1
Sequence:CCGGCTGATCGCAGACCTTCCTTCACTCGAGTGAAGGAAGGTCTGCGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145124.2-1005s21c1
Sequence:CCGGAGGGCACACGTACCAACTATCCTCGAGGATAGTTGGTACGTGTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145124.2-3675s21c1
Sequence:CCGGTGCTTCCTGTTCCTTGCCTAACTCGAGTTAGGCAAGGAACAGGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145124.2-1058s21c1
Sequence:CCGGCTCTATGACAACGCCCAAATCCTCGAGGATTTGGGCGTTGTCATAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145124.2-2496s21c1
Sequence:CCGGTCGATGTCACTGCTACCAATACTCGAGTATTGGTAGCAGTGACATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145124
VALIDATED
MIB2 MISSION shRNA shRNA Plasmid DNA
mindbomb E3 ubiquitin protein ligase 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145124.1-2893s1c1
Sequence:CCGGTCGAAGGATGAAGAAGTGTATCTCGAGATACACTTCTTCATCCTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145124.1-1412s1c1
Sequence:CCGGGTGGTGAAGGTGTTTGGAGATCTCGAGATCTCCAAACACCTTCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145124.1-646s1c1
Sequence:CCGGGCTCTATGACAACGCCCAAATCTCGAGATTTGGGCGTTGTCATAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145124.1-814s1c1
Sequence:CCGGGCGCTATGAGACATCTCACTTCTCGAGAAGTGAGATGTCTCATAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145124.1-2592s1c1
Sequence:CCGGGTGCTGATGTGACTACGCAAACTCGAGTTTGCGTAGTCACATCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145124.2-3359s21c1
Sequence:CCGGGACGGCTCAGAGGTGGTAAATCTCGAGATTTACCACCTCTGAGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145124.2-3236s21c1
Sequence:CCGGTCGGAGCTGGCATTGCTAATTCTCGAGAATTAGCAATGCCAGCTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145124.2-3619s21c1
Sequence:CCGGCTGATCGCAGACCTTCCTTCACTCGAGTGAAGGAAGGTCTGCGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145124.2-1005s21c1
Sequence:CCGGAGGGCACACGTACCAACTATCCTCGAGGATAGTTGGTACGTGTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145124.2-3675s21c1
Sequence:CCGGTGCTTCCTGTTCCTTGCCTAACTCGAGTTAGGCAAGGAACAGGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145124.2-1058s21c1
Sequence:CCGGCTCTATGACAACGCCCAAATCCTCGAGGATTTGGGCGTTGTCATAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145124.2-2496s21c1
Sequence:CCGGTCGATGTCACTGCTACCAATACTCGAGTATTGGTAGCAGTGACATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145124
VALIDATED
MIB2 MISSION shRNA Lentiviral Transduction Particles
mindbomb E3 ubiquitin protein ligase 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145124.1-2893s1c1
Sequence:CCGGTCGAAGGATGAAGAAGTGTATCTCGAGATACACTTCTTCATCCTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145124.1-1412s1c1
Sequence:CCGGGTGGTGAAGGTGTTTGGAGATCTCGAGATCTCCAAACACCTTCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145124.1-646s1c1
Sequence:CCGGGCTCTATGACAACGCCCAAATCTCGAGATTTGGGCGTTGTCATAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145124.1-814s1c1
Sequence:CCGGGCGCTATGAGACATCTCACTTCTCGAGAAGTGAGATGTCTCATAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145124.1-2592s1c1
Sequence:CCGGGTGCTGATGTGACTACGCAAACTCGAGTTTGCGTAGTCACATCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145124.2-3359s21c1
Sequence:CCGGGACGGCTCAGAGGTGGTAAATCTCGAGATTTACCACCTCTGAGCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145124.2-3236s21c1
Sequence:CCGGTCGGAGCTGGCATTGCTAATTCTCGAGAATTAGCAATGCCAGCTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145124.2-3619s21c1
Sequence:CCGGCTGATCGCAGACCTTCCTTCACTCGAGTGAAGGAAGGTCTGCGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145124.2-1005s21c1
Sequence:CCGGAGGGCACACGTACCAACTATCCTCGAGGATAGTTGGTACGTGTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145124.2-3675s21c1
Sequence:CCGGTGCTTCCTGTTCCTTGCCTAACTCGAGTTAGGCAAGGAACAGGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145124.2-1058s21c1
Sequence:CCGGCTCTATGACAACGCCCAAATCCTCGAGGATTTGGGCGTTGTCATAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145124.2-2496s21c1
Sequence:CCGGTCGATGTCACTGCTACCAATACTCGAGTATTGGTAGCAGTGACATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)