EMAIL THIS PAGE TO A FRIEND

MICAL2

microtubule associated monooxygenase, calponin and LIM domain containing 2

123 Gene Product Result for
Synonyms: MICAL-2 MICAL2PV1 MICAL2PV2
Gene ID:
Mouse(320878) microtubule associated monooxygenase, calponin and LIM domain containing 2
Rat(365352) microtubule associated monooxygenase, calponin and LIM domain containing 2
domestic guinea pig(100735168) microtubule associated monooxygenase, calponin and LIM domain containing 2
naked mole-rat(101712859) microtubule associated monooxygenase, calponin and LIM domain containing 2
Domestic Rabbit(100353897) microtubule associated monoxygenase, calponin and LIM domain containing 2
sheep(101121880) microtubule associated monoxygenase, calponin and LIM domain containing 2
chicken(423031) microtubule associated monoxygenase, calponin and LIM domain containing 2
domestic cat(101091046) microtubule associated monoxygenase, calponin and LIM domain containing 2
cow(534041) microtubule associated monooxygenase, calponin and LIM domain containing 2
Horse(100055978) microtubule associated monoxygenase, calponin and LIM domain containing 2
dog(476858) microtubule associated monoxygenase, calponin and LIM domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177282 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177282 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177282 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014632 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU009741 MISSION® esiRNA esiRNA targeting mouse Mical2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014632 Rosetta Predictions human pricing
XM_001074357 Rosetta Predictions rat pricing
XM_344951 Rosetta Predictions rat pricing
NM_177282 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075929 predicted 1804
2 SASI_Hs01_00075930 predicted 3289
3 SASI_Hs01_00075931 predicted 2092
4 SASI_Hs01_00075933 predicted 917
5 SASI_Hs02_00345932 predicted 655
6 SASI_Hs01_00075934 predicted 2955
7 SASI_Hs02_00345933 predicted 3239
8 SASI_Hs01_00075936 predicted 1968
9 SASI_Hs01_00075937 predicted 907
10 SASI_Hs02_00345934 predicted 1350
11 SASI_Hs01_00075932 predicted 1364
12 SASI_Hs01_00075935 predicted 1073
13 SASI_Hs01_00075938 predicted 3152
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345922 predicted 1874
2 SASI_Rn02_00345923 predicted 2586
3 SASI_Rn02_00345924 predicted 363
4 SASI_Rn02_00345925 predicted 738
5 SASI_Rn02_00345926 predicted 629
6 SASI_Rn02_00345927 predicted 1046
7 SASI_Rn02_00345928 predicted 1938
8 SASI_Rn02_00345929 predicted 849
9 SASI_Rn02_00345930 predicted 1324
10 SASI_Rn02_00345931 predicted 1537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344951 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397781 predicted 1876
2 SASI_Rn02_00397782 predicted 2589
3 SASI_Rn02_00397783 predicted 360
4 SASI_Rn02_00397784 predicted 733
5 SASI_Rn02_00397785 predicted 623
6 SASI_Rn02_00397786 predicted 598
7 SASI_Rn02_00397787 predicted 1938
8 SASI_Rn02_00397788 predicted 848
9 SASI_Rn02_00397789 predicted 1318
10 SASI_Rn02_00397790 predicted 1535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038712 predicted 2369
2 SASI_Mm01_00038713 predicted 2092
3 SASI_Mm02_00347347 predicted 2161
4 SASI_Mm01_00038714 predicted 909
5 SASI_Mm01_00038715 predicted 1337
6 SASI_Mm01_00038717 predicted 2808
7 SASI_Mm01_00038718 predicted 1815
8 SASI_Mm01_00038719 predicted 1111
9 SASI_Mm01_00038720 predicted 3010
10 SASI_Mm01_00038721 predicted 1131
11 SASI_Mm01_00038716 predicted 689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177282
VALIDATED
MICAL2 MISSION shRNA Bacterial Glycerol Stock
microtubule associated monooxygenase, calponin and LIM domain containing 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177282.2-2409s1c1
Sequence:CCGGGCTCCAGTCAAGAGTATGCTACTCGAGTAGCATACTCTTGACTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177282.2-3169s1c1
Sequence:CCGGGCTCAGGTTTATCCCAGTGAACTCGAGTTCACTGGGATAAACCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177282.2-3299s1c1
Sequence:CCGGCAAGCCAAAGAGTCCCACATTCTCGAGAATGTGGGACTCTTTGGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177282.2-3215s1c1
Sequence:CCGGGCAGTGCCCTAACATTTCCAACTCGAGTTGGAAATGTTAGGGCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177282.2-2002s1c1
Sequence:CCGGGATCAACTTTGACTCGCTGAACTCGAGTTCAGCGAGTCAAAGTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177282.2-3274s1c1
Sequence:CCGGGCCAGCATCTGTAACCAATTACTCGAGTAATTGGTTACAGATGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177282.4-3180s21c1
Sequence:CCGGGCAGTGCCCTAACATTTCCAACTCGAGTTGGAAATGTTAGGGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177282.4-1967s21c1
Sequence:CCGGGATCAACTTTGACTCGCTGAACTCGAGTTCAGCGAGTCAAAGTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177282.4-707s1c1
Sequence:CCGGCAAGAAGTTCTATGGGAAATTCTCGAGAATTTCCCATAGAACTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177282.4-2664s1c1
Sequence:CCGGGACTGCGATGAAGGCAAATTTCTCGAGAAATTTGCCTTCATCGCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177282.4-3134s21c1
Sequence:CCGGGCTCAGGTTTATCCCAGTGAACTCGAGTTCACTGGGATAAACCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177282.4-3239s21c1
Sequence:CCGGGCCAGCATCTGTAACCAATTACTCGAGTAATTGGTTACAGATGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177282.4-3264s21c1
Sequence:CCGGCAAGCCAAAGAGTCCCACATTCTCGAGAATGTGGGACTCTTTGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177282
VALIDATED
MICAL2 MISSION shRNA shRNA Plasmid DNA
microtubule associated monooxygenase, calponin and LIM domain containing 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177282.2-2409s1c1
Sequence:CCGGGCTCCAGTCAAGAGTATGCTACTCGAGTAGCATACTCTTGACTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177282.2-3169s1c1
Sequence:CCGGGCTCAGGTTTATCCCAGTGAACTCGAGTTCACTGGGATAAACCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177282.2-3299s1c1
Sequence:CCGGCAAGCCAAAGAGTCCCACATTCTCGAGAATGTGGGACTCTTTGGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177282.2-3215s1c1
Sequence:CCGGGCAGTGCCCTAACATTTCCAACTCGAGTTGGAAATGTTAGGGCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177282.2-2002s1c1
Sequence:CCGGGATCAACTTTGACTCGCTGAACTCGAGTTCAGCGAGTCAAAGTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177282.2-3274s1c1
Sequence:CCGGGCCAGCATCTGTAACCAATTACTCGAGTAATTGGTTACAGATGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177282.4-3180s21c1
Sequence:CCGGGCAGTGCCCTAACATTTCCAACTCGAGTTGGAAATGTTAGGGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177282.4-1967s21c1
Sequence:CCGGGATCAACTTTGACTCGCTGAACTCGAGTTCAGCGAGTCAAAGTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177282.4-707s1c1
Sequence:CCGGCAAGAAGTTCTATGGGAAATTCTCGAGAATTTCCCATAGAACTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177282.4-2664s1c1
Sequence:CCGGGACTGCGATGAAGGCAAATTTCTCGAGAAATTTGCCTTCATCGCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177282.4-3134s21c1
Sequence:CCGGGCTCAGGTTTATCCCAGTGAACTCGAGTTCACTGGGATAAACCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177282.4-3239s21c1
Sequence:CCGGGCCAGCATCTGTAACCAATTACTCGAGTAATTGGTTACAGATGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177282.4-3264s21c1
Sequence:CCGGCAAGCCAAAGAGTCCCACATTCTCGAGAATGTGGGACTCTTTGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177282
VALIDATED
MICAL2 MISSION shRNA Lentiviral Transduction Particles
microtubule associated monooxygenase, calponin and LIM domain containing 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177282.2-2409s1c1
Sequence:CCGGGCTCCAGTCAAGAGTATGCTACTCGAGTAGCATACTCTTGACTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177282.2-3169s1c1
Sequence:CCGGGCTCAGGTTTATCCCAGTGAACTCGAGTTCACTGGGATAAACCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177282.2-3299s1c1
Sequence:CCGGCAAGCCAAAGAGTCCCACATTCTCGAGAATGTGGGACTCTTTGGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177282.2-3215s1c1
Sequence:CCGGGCAGTGCCCTAACATTTCCAACTCGAGTTGGAAATGTTAGGGCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177282.2-2002s1c1
Sequence:CCGGGATCAACTTTGACTCGCTGAACTCGAGTTCAGCGAGTCAAAGTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177282.2-3274s1c1
Sequence:CCGGGCCAGCATCTGTAACCAATTACTCGAGTAATTGGTTACAGATGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177282.4-3180s21c1
Sequence:CCGGGCAGTGCCCTAACATTTCCAACTCGAGTTGGAAATGTTAGGGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177282.4-1967s21c1
Sequence:CCGGGATCAACTTTGACTCGCTGAACTCGAGTTCAGCGAGTCAAAGTTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177282.4-707s1c1
Sequence:CCGGCAAGAAGTTCTATGGGAAATTCTCGAGAATTTCCCATAGAACTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177282.4-2664s1c1
Sequence:CCGGGACTGCGATGAAGGCAAATTTCTCGAGAAATTTGCCTTCATCGCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177282.4-3134s21c1
Sequence:CCGGGCTCAGGTTTATCCCAGTGAACTCGAGTTCACTGGGATAAACCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177282.4-3239s21c1
Sequence:CCGGGCCAGCATCTGTAACCAATTACTCGAGTAATTGGTTACAGATGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177282.4-3264s21c1
Sequence:CCGGCAAGCCAAAGAGTCCCACATTCTCGAGAATGTGGGACTCTTTGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014632
VALIDATED
MICAL2 MISSION shRNA Bacterial Glycerol Stock
microtubule associated monooxygenase, calponin and LIM domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014632.2-3448s1c1
Sequence:CCGGCCTCACTTCATTCACTGTAAACTCGAGTTTACAGTGAATGAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014632.2-1644s1c1
Sequence:CCGGCCCGGAGAACATCAACAAGAACTCGAGTTCTTGTTGATGTTCTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014632.2-2216s1c1
Sequence:CCGGGCTTGGCCAAATCATCCATTTCTCGAGAAATGGATGATTTGGCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014632.2-3285s1c1
Sequence:CCGGCGACACGTGTTACTTCTGTAACTCGAGTTACAGAAGTAACACGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014632.2-1212s1c1
Sequence:CCGGGCTCGACAAAGGTGTCATCATCTCGAGATGATGACACCTTTGTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014632.2-3418s21c1
Sequence:CCGGGACTGCGATGAAGGCAAATTTCTCGAGAAATTTGCCTTCATCGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014632.2-3679s21c1
Sequence:CCGGAGAGTCTCCCTCCCTTTATAGCTCGAGCTATAAAGGGAGGGAGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014632.2-1164s21c1
Sequence:CCGGCAAGGACTGCACCCACTATTTCTCGAGAAATAGTGGGTGCAGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014632.2-929s21c1
Sequence:CCGGTTGAGTTTGACGTCATCATTGCTCGAGCAATGATGACGTCAAACTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014632.2-473s21c1
Sequence:CCGGCCAAAGCCCTGTGGTACAAATCTCGAGATTTGTACCACAGGGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014632
VALIDATED
MICAL2 MISSION shRNA shRNA Plasmid DNA
microtubule associated monooxygenase, calponin and LIM domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014632.2-3448s1c1
Sequence:CCGGCCTCACTTCATTCACTGTAAACTCGAGTTTACAGTGAATGAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014632.2-1644s1c1
Sequence:CCGGCCCGGAGAACATCAACAAGAACTCGAGTTCTTGTTGATGTTCTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014632.2-2216s1c1
Sequence:CCGGGCTTGGCCAAATCATCCATTTCTCGAGAAATGGATGATTTGGCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014632.2-3285s1c1
Sequence:CCGGCGACACGTGTTACTTCTGTAACTCGAGTTACAGAAGTAACACGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014632.2-1212s1c1
Sequence:CCGGGCTCGACAAAGGTGTCATCATCTCGAGATGATGACACCTTTGTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014632.2-3418s21c1
Sequence:CCGGGACTGCGATGAAGGCAAATTTCTCGAGAAATTTGCCTTCATCGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014632.2-3679s21c1
Sequence:CCGGAGAGTCTCCCTCCCTTTATAGCTCGAGCTATAAAGGGAGGGAGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014632.2-1164s21c1
Sequence:CCGGCAAGGACTGCACCCACTATTTCTCGAGAAATAGTGGGTGCAGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014632.2-929s21c1
Sequence:CCGGTTGAGTTTGACGTCATCATTGCTCGAGCAATGATGACGTCAAACTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014632.2-473s21c1
Sequence:CCGGCCAAAGCCCTGTGGTACAAATCTCGAGATTTGTACCACAGGGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014632
VALIDATED
MICAL2 MISSION shRNA Lentiviral Transduction Particles
microtubule associated monooxygenase, calponin and LIM domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014632.2-3448s1c1
Sequence:CCGGCCTCACTTCATTCACTGTAAACTCGAGTTTACAGTGAATGAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014632.2-1644s1c1
Sequence:CCGGCCCGGAGAACATCAACAAGAACTCGAGTTCTTGTTGATGTTCTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014632.2-2216s1c1
Sequence:CCGGGCTTGGCCAAATCATCCATTTCTCGAGAAATGGATGATTTGGCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014632.2-3285s1c1
Sequence:CCGGCGACACGTGTTACTTCTGTAACTCGAGTTACAGAAGTAACACGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014632.2-1212s1c1
Sequence:CCGGGCTCGACAAAGGTGTCATCATCTCGAGATGATGACACCTTTGTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014632.2-3418s21c1
Sequence:CCGGGACTGCGATGAAGGCAAATTTCTCGAGAAATTTGCCTTCATCGCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014632.2-3679s21c1
Sequence:CCGGAGAGTCTCCCTCCCTTTATAGCTCGAGCTATAAAGGGAGGGAGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014632.2-1164s21c1
Sequence:CCGGCAAGGACTGCACCCACTATTTCTCGAGAAATAGTGGGTGCAGTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014632.2-929s21c1
Sequence:CCGGTTGAGTTTGACGTCATCATTGCTCGAGCAATGATGACGTCAAACTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014632.2-473s21c1
Sequence:CCGGCCAAAGCCCTGTGGTACAAATCTCGAGATTTGTACCACAGGGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)