EMAIL THIS PAGE TO A FRIEND

MICAL3

microtubule associated monooxygenase, calponin and LIM domain containing 3

78 Gene Product Result for
Synonyms: MICAL-3
Gene ID:
Mouse(194401) microtubule associated monooxygenase, calponin and LIM domain containing 3
Rat(362427) microtubule associated monooxygenase, calponin and LIM domain containing 3
chicken(418164) microtubule associated monoxygenase, calponin and LIM domain containing 3
cow(532244) microtubule associated monoxygenase, calponin and LIM domain containing 3
domestic cat(101081558) microtubule associated monoxygenase, calponin and LIM domain containing 3
dog(486761) microtubule associated monoxygenase, calponin and LIM domain containing 3
sheep(101118097) microtubule associated monoxygenase, calponin and LIM domain containing 3
Domestic Rabbit(100354238) microtubule associated monoxygenase, calponin and LIM domain containing 3
naked mole-rat(101709910) microtubule associated monooxygenase, calponin and LIM domain containing 3
domestic guinea pig(100726239) microtubule associated monooxygenase, calponin and LIM domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153396 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153396 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153396 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_032997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_032997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_032997 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122731 Rosetta Predictions human pricing
XM_032996 Rosetta Predictions human pricing
XM_001064549 Rosetta Predictions rat pricing
NM_153396 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327245 predicted 2170
2 SASI_Hs02_00327246 predicted 717
3 SASI_Hs02_00327247 predicted 2118
4 SASI_Hs02_00327248 predicted 858
5 SASI_Hs02_00327249 predicted 1719
6 SASI_Hs02_00327250 predicted 1272
7 SASI_Hs02_00327251 predicted 1971
8 SASI_Hs02_00327252 predicted 1451
9 SASI_Hs02_00327253 predicted 1619
10 SASI_Hs02_00327254 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_032996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288128 predicted 3235
2 SASI_Hs01_00288129 predicted 542
3 SASI_Hs01_00288130 predicted 2454
4 SASI_Hs01_00288131 predicted 1128
5 SASI_Hs01_00288132 predicted 3471
6 SASI_Hs01_00288133 predicted 2861
7 SASI_Hs01_00288134 predicted 275
8 SASI_Hs01_00288135 predicted 2739
9 SASI_Hs01_00288136 predicted 1138
10 SASI_Hs01_00288137 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310969 predicted 553
2 SASI_Rn02_00310970 predicted 742
3 SASI_Rn02_00310971 predicted 740
4 SASI_Rn02_00310972 predicted 846
5 SASI_Rn02_00310973 predicted 329
6 SASI_Rn02_00310974 predicted 640
7 SASI_Rn02_00310975 predicted 346
8 SASI_Rn02_00310976 predicted 413
9 SASI_Rn02_00310977 predicted 539
10 SASI_Rn02_00310978 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086241 predicted 790
2 SASI_Mm01_00086240 predicted 1673
3 SASI_Mm01_00086242 predicted 1891
4 SASI_Mm02_00343177 predicted 2020
5 SASI_Mm01_00086243 predicted 2087
6 SASI_Mm01_00086245 predicted 952
7 SASI_Mm02_00343178 predicted 2118
8 SASI_Mm01_00086246 predicted 1882
9 SASI_Mm01_00086247 predicted 1144
10 SASI_Mm01_00086248 predicted 1444
11 SASI_Mm01_00086239 predicted 2607
12 SASI_Mm01_00086244 predicted 1097
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153396
VALIDATED
MICAL3 MISSION shRNA Bacterial Glycerol Stock
microtubule associated monooxygenase, calponin and LIM domain containing 3
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-1876s21c1
Sequence:CCGGGGCTATTCAGGAGTCAATGTGCTCGAGCACATTGACTCCTGAATAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-1334s21c1
Sequence:CCGGCTCTGGATTTCGCCATCAATCCTCGAGGATTGATGGCGAAATCCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-2123s21c1
Sequence:CCGGTCACGCAGTTCTACGAGATGTCTCGAGACATCTCGTAGAACTGCGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-898s21c1
Sequence:CCGGACTCATCCTGTATCAGAATATCTCGAGATATTCTGATACAGGATGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-493s21c1
Sequence:CCGGGGCAGTCACAAAGACTACAAACTCGAGTTTGTAGTCTTTGTGACTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-2508s21c1
Sequence:CCGGGAGGAGACAGGGCTCCATAAACTCGAGTTTATGGAGCCCTGTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-305s21c1
Sequence:CCGGACCAAGCTCACGTCCTCTTTGCTCGAGCAAAGAGGACGTGAGCTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-1678s21c1
Sequence:CCGGGTCACTAGGTATCCCAATATCCTCGAGGATATTGGGATACCTAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-632s21c1
Sequence:CCGGATGCCTTCTCCCGCAACAATGCTCGAGCATTGTTGCGGGAGAAGGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153396.1-1088s1c1
Sequence:CCGGGCTGAGAGAAACCACAGGTATCTCGAGATACCTGTGGTTTCTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153396.1-2678s1c1
Sequence:CCGGCGAGGATGAGTTCTCTCCAAACTCGAGTTTGGAGAGAACTCATCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153396.1-585s1c1
Sequence:CCGGGCCAAGGTGGTTGTTATTGAACTCGAGTTCAATAACAACCACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153396.1-982s1c1
Sequence:CCGGCCATTGCCATTACAGCAAATTCTCGAGAATTTGCTGTAATGGCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153396.1-1941s1c1
Sequence:CCGGCCCGATCTAATAGACTTTGATCTCGAGATCAAAGTCTATTAGATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153396
VALIDATED
MICAL3 MISSION shRNA shRNA Plasmid DNA
microtubule associated monooxygenase, calponin and LIM domain containing 3
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-1876s21c1
Sequence:CCGGGGCTATTCAGGAGTCAATGTGCTCGAGCACATTGACTCCTGAATAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-1334s21c1
Sequence:CCGGCTCTGGATTTCGCCATCAATCCTCGAGGATTGATGGCGAAATCCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-2123s21c1
Sequence:CCGGTCACGCAGTTCTACGAGATGTCTCGAGACATCTCGTAGAACTGCGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-898s21c1
Sequence:CCGGACTCATCCTGTATCAGAATATCTCGAGATATTCTGATACAGGATGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-493s21c1
Sequence:CCGGGGCAGTCACAAAGACTACAAACTCGAGTTTGTAGTCTTTGTGACTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-2508s21c1
Sequence:CCGGGAGGAGACAGGGCTCCATAAACTCGAGTTTATGGAGCCCTGTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-305s21c1
Sequence:CCGGACCAAGCTCACGTCCTCTTTGCTCGAGCAAAGAGGACGTGAGCTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-1678s21c1
Sequence:CCGGGTCACTAGGTATCCCAATATCCTCGAGGATATTGGGATACCTAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-632s21c1
Sequence:CCGGATGCCTTCTCCCGCAACAATGCTCGAGCATTGTTGCGGGAGAAGGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153396.1-1088s1c1
Sequence:CCGGGCTGAGAGAAACCACAGGTATCTCGAGATACCTGTGGTTTCTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153396.1-2678s1c1
Sequence:CCGGCGAGGATGAGTTCTCTCCAAACTCGAGTTTGGAGAGAACTCATCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153396.1-585s1c1
Sequence:CCGGGCCAAGGTGGTTGTTATTGAACTCGAGTTCAATAACAACCACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153396.1-982s1c1
Sequence:CCGGCCATTGCCATTACAGCAAATTCTCGAGAATTTGCTGTAATGGCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153396.1-1941s1c1
Sequence:CCGGCCCGATCTAATAGACTTTGATCTCGAGATCAAAGTCTATTAGATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153396
VALIDATED
MICAL3 MISSION shRNA Lentiviral Transduction Particles
microtubule associated monooxygenase, calponin and LIM domain containing 3
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-1876s21c1
Sequence:CCGGGGCTATTCAGGAGTCAATGTGCTCGAGCACATTGACTCCTGAATAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-1334s21c1
Sequence:CCGGCTCTGGATTTCGCCATCAATCCTCGAGGATTGATGGCGAAATCCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-2123s21c1
Sequence:CCGGTCACGCAGTTCTACGAGATGTCTCGAGACATCTCGTAGAACTGCGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-898s21c1
Sequence:CCGGACTCATCCTGTATCAGAATATCTCGAGATATTCTGATACAGGATGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-493s21c1
Sequence:CCGGGGCAGTCACAAAGACTACAAACTCGAGTTTGTAGTCTTTGTGACTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-2508s21c1
Sequence:CCGGGAGGAGACAGGGCTCCATAAACTCGAGTTTATGGAGCCCTGTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-305s21c1
Sequence:CCGGACCAAGCTCACGTCCTCTTTGCTCGAGCAAAGAGGACGTGAGCTTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-1678s21c1
Sequence:CCGGGTCACTAGGTATCCCAATATCCTCGAGGATATTGGGATACCTAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153396.2-632s21c1
Sequence:CCGGATGCCTTCTCCCGCAACAATGCTCGAGCATTGTTGCGGGAGAAGGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153396.1-1088s1c1
Sequence:CCGGGCTGAGAGAAACCACAGGTATCTCGAGATACCTGTGGTTTCTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153396.1-2678s1c1
Sequence:CCGGCGAGGATGAGTTCTCTCCAAACTCGAGTTTGGAGAGAACTCATCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153396.1-585s1c1
Sequence:CCGGGCCAAGGTGGTTGTTATTGAACTCGAGTTCAATAACAACCACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153396.1-982s1c1
Sequence:CCGGCCATTGCCATTACAGCAAATTCTCGAGAATTTGCTGTAATGGCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153396.1-1941s1c1
Sequence:CCGGCCCGATCTAATAGACTTTGATCTCGAGATCAAAGTCTATTAGATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_032997
MICAL3 MISSION shRNA Bacterial Glycerol Stock
microtubule associated monooxygenase, calponin and LIM domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032997.5-723s1c1
Sequence:CCGGCGGAAAGAATTCCGTGGCAAACTCGAGTTTGCCACGGAATTCTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032997.5-1868s1c1
Sequence:CCGGCCTGACTCAGTTCTACGAGATCTCGAGATCTCGTAGAACTGAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032997.5-414s1c1
Sequence:CCGGCCATTCACCATACATGATCTACTCGAGTAGATCATGTATGGTGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032997.5-1971s1c1
Sequence:CCGGCCTATCTCCTTCCTAAGCAAACTCGAGTTTGCTTAGGAAGGAGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032997.5-1379s1c1
Sequence:CCGGCCCTGAGAATGTGAGTAAGAACTCGAGTTCTTACTCACATTCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_032997
MICAL3 MISSION shRNA shRNA Plasmid DNA
microtubule associated monooxygenase, calponin and LIM domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032997.5-723s1c1
Sequence:CCGGCGGAAAGAATTCCGTGGCAAACTCGAGTTTGCCACGGAATTCTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032997.5-1868s1c1
Sequence:CCGGCCTGACTCAGTTCTACGAGATCTCGAGATCTCGTAGAACTGAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032997.5-414s1c1
Sequence:CCGGCCATTCACCATACATGATCTACTCGAGTAGATCATGTATGGTGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032997.5-1971s1c1
Sequence:CCGGCCTATCTCCTTCCTAAGCAAACTCGAGTTTGCTTAGGAAGGAGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032997.5-1379s1c1
Sequence:CCGGCCCTGAGAATGTGAGTAAGAACTCGAGTTCTTACTCACATTCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_032997
MICAL3 MISSION shRNA Lentiviral Transduction Particles
microtubule associated monooxygenase, calponin and LIM domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032997.5-723s1c1
Sequence:CCGGCGGAAAGAATTCCGTGGCAAACTCGAGTTTGCCACGGAATTCTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032997.5-1868s1c1
Sequence:CCGGCCTGACTCAGTTCTACGAGATCTCGAGATCTCGTAGAACTGAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032997.5-414s1c1
Sequence:CCGGCCATTCACCATACATGATCTACTCGAGTAGATCATGTATGGTGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032997.5-1971s1c1
Sequence:CCGGCCTATCTCCTTCCTAAGCAAACTCGAGTTTGCTTAGGAAGGAGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032997.5-1379s1c1
Sequence:CCGGCCCTGAGAATGTGAGTAAGAACTCGAGTTCTTACTCACATTCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)