EMAIL THIS PAGE TO A FRIEND

MICALCL

MICAL C-terminal like

76 Gene Product Result for
Synonyms: Ebitein1
UniProtKB ID: Q6ZW33, Q7RTP7, Q96JU6
Gene ID:
Mouse(100504195) MICAL C-terminal like
Rat(293180) MICAL C-terminal like
chicken(428844) MICAL C-terminal like
domestic cat(101093641) MICAL C-terminal like
cow(100847927) MICAL C-terminal like
Horse(100071462) MICAL C-terminal like
dog(100684733) MICAL C-terminal like
domestic guinea pig(100729059) MICAL C-terminal like
naked mole-rat(101714288) MICAL C-terminal like
sheep(101122052) MICAL C-terminal like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032867 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032867 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032867 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002021 MISSION® esiRNA esiRNA targeting human MICALCL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032867 Rosetta Predictions human pricing
NM_182669 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360477 predicted 1212
2 SASI_Hs02_00360478 predicted 2272
3 SASI_Hs02_00360479 predicted 610
4 SASI_Hs02_00360480 predicted 2322
5 SASI_Hs01_00112177 predicted 2449
6 SASI_Hs01_00112181 predicted 1066
7 SASI_Hs01_00112182 predicted 2087
8 SASI_Hs02_00360481 predicted 2254
9 SASI_Hs02_00360482 predicted 1429
10 SASI_Hs02_00360483 predicted 1409
11 SASI_Hs01_00112174 predicted 1902
12 SASI_Hs01_00112175 predicted 1912
13 SASI_Hs01_00112176 predicted 1998
14 SASI_Hs01_00112178 predicted 1523
15 SASI_Hs01_00112179 predicted 1538
16 SASI_Hs01_00112180 predicted 1778
17 SASI_Hs01_00112183 predicted 1603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109555 predicted 1014
2 SASI_Rn01_00109556 predicted 559
3 SASI_Rn01_00109557 predicted 2026
4 SASI_Rn01_00109558 predicted 1131
5 SASI_Rn01_00109560 predicted 2032
6 SASI_Rn02_00269814 predicted 1059
7 SASI_Rn01_00109561 predicted 1258
8 SASI_Rn02_00269815 predicted 795
9 SASI_Rn02_00269816 predicted 850
10 SASI_Rn01_00109562 predicted 1940
11 SASI_Rn01_00109559 predicted 2023
12 SASI_Rn01_00109563 predicted 1935
13 SASI_Rn01_00109564 predicted 1236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032867
MICALCL MISSION shRNA Bacterial Glycerol Stock
MICAL C-terminal like
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1138s1c1
Sequence:CCGGCCCAGCTTTCCTTGCAGTTAACTCGAGTTAACTGCAAGGAAAGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1593s1c1
Sequence:CCGGCAAAGGGACAAACTCGTCGATCTCGAGATCGACGAGTTTGTCCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1209s1c1
Sequence:CCGGCAGTTGGTTAAGCAAGAAGAACTCGAGTTCTTCTTGCTTAACCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1139s1c1
Sequence:CCGGCCAGCTTTCCTTGCAGTTAAACTCGAGTTTAACTGCAAGGAAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032867.2-2243s21c1
Sequence:CCGGCCGAGCTGATGCAAGTGATTGCTCGAGCAATCACTTGCATCAGCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032867.1-2008s1c1
Sequence:CCGGGACTTGACTTTCCTGCTACTTCTCGAGAAGTAGCAGGAAAGTCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1476s1c1
Sequence:CCGGCAAAGCAGACTGGAGCAGAAACTCGAGTTTCTGCTCCAGTCTGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032867.1-2159s1c1
Sequence:CCGGCCGCAGTTTAAAGATTAGGTTCTCGAGAACCTAATCTTTAAACTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1488s1c1
Sequence:CCGGGAGCAGAAACTGAGAGAGAAACTCGAGTTTCTCTCTCAGTTTCTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032867.2-2721s21c1
Sequence:CCGGCATTGAGTTACATACTTTAAGCTCGAGCTTAAAGTATGTAACTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032867.2-1340s21c1
Sequence:CCGGATCGGCCATCCAAGGTCTTTCCTCGAGGAAAGACCTTGGATGGCCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032867.2-2439s21c1
Sequence:CCGGACACACCCTCATGGGTCTTTCCTCGAGGAAAGACCCATGAGGGTGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032867
MICALCL MISSION shRNA shRNA Plasmid DNA
MICAL C-terminal like
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1138s1c1
Sequence:CCGGCCCAGCTTTCCTTGCAGTTAACTCGAGTTAACTGCAAGGAAAGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1593s1c1
Sequence:CCGGCAAAGGGACAAACTCGTCGATCTCGAGATCGACGAGTTTGTCCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1209s1c1
Sequence:CCGGCAGTTGGTTAAGCAAGAAGAACTCGAGTTCTTCTTGCTTAACCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1139s1c1
Sequence:CCGGCCAGCTTTCCTTGCAGTTAAACTCGAGTTTAACTGCAAGGAAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032867.2-2243s21c1
Sequence:CCGGCCGAGCTGATGCAAGTGATTGCTCGAGCAATCACTTGCATCAGCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032867.1-2008s1c1
Sequence:CCGGGACTTGACTTTCCTGCTACTTCTCGAGAAGTAGCAGGAAAGTCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1476s1c1
Sequence:CCGGCAAAGCAGACTGGAGCAGAAACTCGAGTTTCTGCTCCAGTCTGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032867.1-2159s1c1
Sequence:CCGGCCGCAGTTTAAAGATTAGGTTCTCGAGAACCTAATCTTTAAACTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1488s1c1
Sequence:CCGGGAGCAGAAACTGAGAGAGAAACTCGAGTTTCTCTCTCAGTTTCTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032867.2-2721s21c1
Sequence:CCGGCATTGAGTTACATACTTTAAGCTCGAGCTTAAAGTATGTAACTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032867.2-1340s21c1
Sequence:CCGGATCGGCCATCCAAGGTCTTTCCTCGAGGAAAGACCTTGGATGGCCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032867.2-2439s21c1
Sequence:CCGGACACACCCTCATGGGTCTTTCCTCGAGGAAAGACCCATGAGGGTGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032867
MICALCL MISSION shRNA Lentiviral Transduction Particles
MICAL C-terminal like
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1138s1c1
Sequence:CCGGCCCAGCTTTCCTTGCAGTTAACTCGAGTTAACTGCAAGGAAAGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1593s1c1
Sequence:CCGGCAAAGGGACAAACTCGTCGATCTCGAGATCGACGAGTTTGTCCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1209s1c1
Sequence:CCGGCAGTTGGTTAAGCAAGAAGAACTCGAGTTCTTCTTGCTTAACCAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1139s1c1
Sequence:CCGGCCAGCTTTCCTTGCAGTTAAACTCGAGTTTAACTGCAAGGAAAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032867.2-2243s21c1
Sequence:CCGGCCGAGCTGATGCAAGTGATTGCTCGAGCAATCACTTGCATCAGCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032867.1-2008s1c1
Sequence:CCGGGACTTGACTTTCCTGCTACTTCTCGAGAAGTAGCAGGAAAGTCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1476s1c1
Sequence:CCGGCAAAGCAGACTGGAGCAGAAACTCGAGTTTCTGCTCCAGTCTGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032867.1-2159s1c1
Sequence:CCGGCCGCAGTTTAAAGATTAGGTTCTCGAGAACCTAATCTTTAAACTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032867.1-1488s1c1
Sequence:CCGGGAGCAGAAACTGAGAGAGAAACTCGAGTTTCTCTCTCAGTTTCTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032867.2-2721s21c1
Sequence:CCGGCATTGAGTTACATACTTTAAGCTCGAGCTTAAAGTATGTAACTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032867.2-1340s21c1
Sequence:CCGGATCGGCCATCCAAGGTCTTTCCTCGAGGAAAGACCTTGGATGGCCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032867.2-2439s21c1
Sequence:CCGGACACACCCTCATGGGTCTTTCCTCGAGGAAAGACCCATGAGGGTGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)