EMAIL THIS PAGE TO A FRIEND

MICALL1

MICAL-like 1

68 Gene Product Result for
Synonyms: MICAL-L1 MIRAB13
Gene ID:
Mouse(27008) microtubule associated monooxygenase, calponin and LIM domain containing -like 1
Rat(362958) MICAL-like 1
sheep(101119899) MICAL-like 1
Zebrafish(100149741) MICAL-like 1
chicken(418032) MICAL-like 1
cow(517259) MICAL-like 1
Horse(100069931) MICAL-like 1
dog(481260) MICAL-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033386 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033386 Rosetta Predictions human pricing
XM_343288 Rosetta Predictions rat pricing
XR_009079 Rosetta Predictions rat pricing
NM_177461 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361239 predicted 2885
2 SASI_Hs01_00087469 predicted 248
3 SASI_Hs01_00087470 predicted 2844
4 SASI_Hs01_00087471 predicted 2252
5 SASI_Hs02_00361240 predicted 2672
6 SASI_Hs01_00087473 predicted 2597
7 SASI_Hs01_00087474 predicted 262
8 SASI_Hs01_00087475 predicted 2455
9 SASI_Hs01_00087477 predicted 715
10 SASI_Hs02_00361241 predicted 2618
11 SASI_Hs01_00087472 predicted 2526
12 SASI_Hs01_00087476 predicted 826
13 SASI_Hs01_00087478 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152783 predicted 2197
2 SASI_Rn01_00152784 predicted 2185
3 SASI_Rn01_00152785 predicted 2264
4 SASI_Rn01_00152786 predicted 2349
5 SASI_Rn01_00152787 predicted 2264
6 SASI_Rn01_00152788 predicted 2191
7 SASI_Rn01_00152789 predicted 2194
8 SASI_Rn01_00152790 predicted 2335
9 SASI_Rn01_00152791 predicted 2198
10 SASI_Rn01_00152792 predicted 2234
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00418706 predicted 1678
2 SASI_Rn02_00418707 predicted 2351
3 SASI_Rn02_00418708 predicted 2104
4 SASI_Rn02_00418709 predicted 2644
5 SASI_Rn02_00418710 predicted 2455
6 SASI_Rn02_00418711 predicted 2470
7 SASI_Rn02_00418712 predicted 2194
8 SASI_Rn02_00418713 predicted 2076
9 SASI_Rn02_00418714 predicted 2171
10 SASI_Rn02_00418715 predicted 2091
11 SASI_Rn01_00185466 predicted 838
12 SASI_Rn01_00185467 predicted 407
13 SASI_Rn01_00185468 predicted 1124
14 SASI_Rn01_00185469 predicted 1249
15 SASI_Rn01_00185470 predicted 387
16 SASI_Rn01_00185471 predicted 488
17 SASI_Rn01_00185472 predicted 274
18 SASI_Rn01_00185473 predicted 653
19 SASI_Rn01_00185474 predicted 353
20 SASI_Rn01_00185475 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347653 predicted 2495
2 SASI_Mm02_00347654 predicted 2758
3 SASI_Mm02_00347655 predicted 2834
4 SASI_Mm02_00347656 predicted 980
5 SASI_Mm02_00347657 predicted 2900
6 SASI_Mm02_00347658 predicted 2213
7 SASI_Mm02_00347659 predicted 453
8 SASI_Mm02_00347660 predicted 2373
9 SASI_Mm02_00347661 predicted 827
10 SASI_Mm02_00347662 predicted 2831
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033386
MICALL1 MISSION shRNA Bacterial Glycerol Stock
MICAL-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033386.2-1785s21c1
Sequence:CCGGGGAGCCTAGAGTGGAACAAATCTCGAGATTTGTTCCACTCTAGGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033386.2-251s21c1
Sequence:CCGGAGGACAATGTCTTCGAGAATACTCGAGTATTCTCGAAGACATTGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033386.2-1338s1c1
Sequence:CCGGCCTGGAGTCCAAACCCTATAACTCGAGTTATAGGGTTTGGACTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033386.2-2473s1c1
Sequence:CCGGGCTATCATCAACTGCCTGGATCTCGAGATCCAGGCAGTTGATGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033386.2-1209s1c1
Sequence:CCGGGCAGGCAGAACCAAAGAAGAACTCGAGTTCTTCTTTGGTTCTGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033386.2-820s1c1
Sequence:CCGGGCAGAAGATGCCAAGGATGTTCTCGAGAACATCCTTGGCATCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033386.2-2848s1c1
Sequence:CCGGCCAAAGAATCTCTTGTTTCTTCTCGAGAAGAAACAAGAGATTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033386
MICALL1 MISSION shRNA shRNA Plasmid DNA
MICAL-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033386.2-1785s21c1
Sequence:CCGGGGAGCCTAGAGTGGAACAAATCTCGAGATTTGTTCCACTCTAGGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033386.2-251s21c1
Sequence:CCGGAGGACAATGTCTTCGAGAATACTCGAGTATTCTCGAAGACATTGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033386.2-1338s1c1
Sequence:CCGGCCTGGAGTCCAAACCCTATAACTCGAGTTATAGGGTTTGGACTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033386.2-2473s1c1
Sequence:CCGGGCTATCATCAACTGCCTGGATCTCGAGATCCAGGCAGTTGATGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033386.2-1209s1c1
Sequence:CCGGGCAGGCAGAACCAAAGAAGAACTCGAGTTCTTCTTTGGTTCTGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033386.2-820s1c1
Sequence:CCGGGCAGAAGATGCCAAGGATGTTCTCGAGAACATCCTTGGCATCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033386.2-2848s1c1
Sequence:CCGGCCAAAGAATCTCTTGTTTCTTCTCGAGAAGAAACAAGAGATTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033386
MICALL1 MISSION shRNA Lentiviral Transduction Particles
MICAL-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033386.2-1785s21c1
Sequence:CCGGGGAGCCTAGAGTGGAACAAATCTCGAGATTTGTTCCACTCTAGGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033386.2-251s21c1
Sequence:CCGGAGGACAATGTCTTCGAGAATACTCGAGTATTCTCGAAGACATTGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033386.2-1338s1c1
Sequence:CCGGCCTGGAGTCCAAACCCTATAACTCGAGTTATAGGGTTTGGACTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033386.2-2473s1c1
Sequence:CCGGGCTATCATCAACTGCCTGGATCTCGAGATCCAGGCAGTTGATGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033386.2-1209s1c1
Sequence:CCGGGCAGGCAGAACCAAAGAAGAACTCGAGTTCTTCTTTGGTTCTGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033386.2-820s1c1
Sequence:CCGGGCAGAAGATGCCAAGGATGTTCTCGAGAACATCCTTGGCATCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033386.2-2848s1c1
Sequence:CCGGCCAAAGAATCTCTTGTTTCTTCTCGAGAAGAAACAAGAGATTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)