EMAIL THIS PAGE TO A FRIEND

MICALL2

MICAL-like 2

78 Gene Product Result for
Synonyms: JRAB MICAL-L2
UniProtKB ID: Q8IY33, Q7RTP4, Q7Z655, Q8TEQ4, Q9H5F9
Gene ID:
Mouse(231830) MICAL-like 2
Rat(288515) MICAL-like 2
chicken(416460) MICAL-like 2
cow(510644) MICAL-like 2
dog(489898) MICAL-like 2
sheep(101114413) MICAL-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024723 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024723 Rosetta Predictions human pricing
NM_182924 Rosetta Predictions human pricing
XM_221956 Rosetta Predictions rat pricing
XR_008946 Rosetta Predictions rat pricing
NM_174850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029198 predicted 1840
2 SASI_Hs01_00029199 predicted 1897
3 SASI_Hs01_00029200 predicted 1008
4 SASI_Hs01_00029201 predicted 677
5 SASI_Hs01_00029202 predicted 1893
6 SASI_Hs01_00029203 predicted 825
7 SASI_Hs01_00029204 predicted 1834
8 SASI_Hs01_00029205 predicted 2053
9 SASI_Hs01_00029206 predicted 672
10 SASI_Hs01_00029207 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371047 predicted 593
2 SASI_Hs02_00371048 predicted 2450
3 SASI_Hs01_00080950 predicted 1314
4 SASI_Hs01_00080951 predicted 2521
5 SASI_Hs02_00371049 predicted 1458
6 SASI_Hs02_00371050 predicted 1582
7 SASI_Hs02_00371051 predicted 1458
8 SASI_Hs02_00371052 predicted 2512
9 SASI_Hs02_00371053 predicted 1310
10 SASI_Hs01_00080953 predicted 2456
11 SASI_Hs01_00080947 predicted 2464
12 SASI_Hs01_00080948 predicted 2525
13 SASI_Hs01_00080949 predicted 1630
14 SASI_Hs01_00080952 predicted 1456
15 SASI_Hs01_00080954 predicted 2669
16 SASI_Hs01_00080955 predicted 1288
17 SASI_Hs01_00080956 predicted 1420
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380458 predicted 3069
2 SASI_Rn02_00380459 predicted 2331
3 SASI_Rn02_00380460 predicted 1377
4 SASI_Rn02_00380461 predicted 74
5 SASI_Rn02_00380462 predicted 698
6 SASI_Rn02_00380463 predicted 2023
7 SASI_Rn02_00380464 predicted 2665
8 SASI_Rn02_00380465 predicted 1044
9 SASI_Rn02_00380466 predicted 1187
10 SASI_Rn02_00380467 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008946 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00418301 predicted 3065
2 SASI_Rn02_00418302 predicted 2331
3 SASI_Rn02_00418303 predicted 1376
4 SASI_Rn02_00418304 predicted 72
5 SASI_Rn01_00144348 predicted 692
6 SASI_Rn02_00418305 predicted 2024
7 SASI_Rn02_00418306 predicted 2659
8 SASI_Rn01_00144351 predicted 1036
9 SASI_Rn01_00144353 predicted 1187
10 SASI_Rn02_00418307 predicted 505
11 SASI_Rn01_00144346 predicted 341
12 SASI_Rn01_00144347 predicted 843
13 SASI_Rn01_00144349 predicted 1020
14 SASI_Rn01_00144350 predicted 1214
15 SASI_Rn01_00144352 predicted 655
16 SASI_Rn01_00144354 predicted 1199
17 SASI_Rn01_00144355 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073903 predicted 2907
2 SASI_Mm01_00073904 predicted 2387
3 SASI_Mm01_00073905 predicted 1789
4 SASI_Mm01_00073906 predicted 2200
5 SASI_Mm01_00073907 predicted 1799
6 SASI_Mm01_00073908 predicted 2853
7 SASI_Mm01_00073909 predicted 1906
8 SASI_Mm01_00073910 predicted 1634
9 SASI_Mm01_00073911 predicted 2827
10 SASI_Mm02_00345503 predicted 2335
11 SASI_Mm01_00073902 predicted 481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024723
MICALL2 MISSION shRNA Bacterial Glycerol Stock
MICAL-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024723.1-1861s1c1
Sequence:CCGGCTCATTCACGAGAAGCAGCTTCTCGAGAAGCTGCTTCTCGTGAATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024723.1-1854s1c1
Sequence:CCGGGTTCTGGCTCATTCACGAGAACTCGAGTTCTCGTGAATGAGCCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024723.1-2160s1c1
Sequence:CCGGGAAGAAGTCCAAGTTCCGCTTCTCGAGAAGCGGAACTTGGACTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024723.1-1531s1c1
Sequence:CCGGGACGTTTGTGACAACTGGCTTCTCGAGAAGCCAGTTGTCACAAACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024723.1-203s1c1
Sequence:CCGGGCGACGTGAATATCTGCAACACTCGAGTGTTGCAGATATTCACGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024723.1-825s1c1
Sequence:CCGGCCCGTCACTTGTTCTATCCAACTCGAGTTGGATAGAACAAGTGACGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024723.1-680s1c1
Sequence:CCGGCACTCAGTTCAAGCTCCACATCTCGAGATGTGGAGCTTGAACTGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024723.1-682s1c1
Sequence:CCGGCTCAGTTCAAGCTCCACATCTCTCGAGAGATGTGGAGCTTGAACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024723.1-204s1c1
Sequence:CCGGCGACGTGAATATCTGCAACATCTCGAGATGTTGCAGATATTCACGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024723
MICALL2 MISSION shRNA shRNA Plasmid DNA
MICAL-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024723.1-1861s1c1
Sequence:CCGGCTCATTCACGAGAAGCAGCTTCTCGAGAAGCTGCTTCTCGTGAATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024723.1-1854s1c1
Sequence:CCGGGTTCTGGCTCATTCACGAGAACTCGAGTTCTCGTGAATGAGCCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024723.1-2160s1c1
Sequence:CCGGGAAGAAGTCCAAGTTCCGCTTCTCGAGAAGCGGAACTTGGACTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024723.1-1531s1c1
Sequence:CCGGGACGTTTGTGACAACTGGCTTCTCGAGAAGCCAGTTGTCACAAACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024723.1-203s1c1
Sequence:CCGGGCGACGTGAATATCTGCAACACTCGAGTGTTGCAGATATTCACGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024723.1-825s1c1
Sequence:CCGGCCCGTCACTTGTTCTATCCAACTCGAGTTGGATAGAACAAGTGACGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024723.1-680s1c1
Sequence:CCGGCACTCAGTTCAAGCTCCACATCTCGAGATGTGGAGCTTGAACTGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024723.1-682s1c1
Sequence:CCGGCTCAGTTCAAGCTCCACATCTCTCGAGAGATGTGGAGCTTGAACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024723.1-204s1c1
Sequence:CCGGCGACGTGAATATCTGCAACATCTCGAGATGTTGCAGATATTCACGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024723
MICALL2 MISSION shRNA Lentiviral Transduction Particles
MICAL-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024723.1-1861s1c1
Sequence:CCGGCTCATTCACGAGAAGCAGCTTCTCGAGAAGCTGCTTCTCGTGAATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024723.1-1854s1c1
Sequence:CCGGGTTCTGGCTCATTCACGAGAACTCGAGTTCTCGTGAATGAGCCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024723.1-2160s1c1
Sequence:CCGGGAAGAAGTCCAAGTTCCGCTTCTCGAGAAGCGGAACTTGGACTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024723.1-1531s1c1
Sequence:CCGGGACGTTTGTGACAACTGGCTTCTCGAGAAGCCAGTTGTCACAAACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024723.1-203s1c1
Sequence:CCGGGCGACGTGAATATCTGCAACACTCGAGTGTTGCAGATATTCACGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024723.1-825s1c1
Sequence:CCGGCCCGTCACTTGTTCTATCCAACTCGAGTTGGATAGAACAAGTGACGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024723.1-680s1c1
Sequence:CCGGCACTCAGTTCAAGCTCCACATCTCGAGATGTGGAGCTTGAACTGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024723.1-682s1c1
Sequence:CCGGCTCAGTTCAAGCTCCACATCTCTCGAGAGATGTGGAGCTTGAACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024723.1-204s1c1
Sequence:CCGGCGACGTGAATATCTGCAACATCTCGAGATGTTGCAGATATTCACGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174850
VALIDATED
MICALL2 MISSION shRNA Bacterial Glycerol Stock
MICAL-like 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000114366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174850.2-2326s1c1
Sequence:CCGGGCCTTGATGTTTCAGCTGATTCTCGAGAATCAGCTGAAACATCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174850.2-910s1c1
Sequence:CCGGCGGAACTTAAGCCACCATCTACTCGAGTAGATGGTGGCTTAAGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174850.2-1806s1c1
Sequence:CCGGCCCAAGAATGAAGTGCCACAACTCGAGTTGTGGCACTTCATTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174850.2-2855s1c1
Sequence:CCGGCCGAAGTGACATCGTTGACTTCTCGAGAAGTCAACGATGTCACTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174850
VALIDATED
MICALL2 MISSION shRNA shRNA Plasmid DNA
MICAL-like 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000114366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174850.2-2326s1c1
Sequence:CCGGGCCTTGATGTTTCAGCTGATTCTCGAGAATCAGCTGAAACATCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174850.2-910s1c1
Sequence:CCGGCGGAACTTAAGCCACCATCTACTCGAGTAGATGGTGGCTTAAGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174850.2-1806s1c1
Sequence:CCGGCCCAAGAATGAAGTGCCACAACTCGAGTTGTGGCACTTCATTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174850.2-2855s1c1
Sequence:CCGGCCGAAGTGACATCGTTGACTTCTCGAGAAGTCAACGATGTCACTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174850
VALIDATED
MICALL2 MISSION shRNA Lentiviral Transduction Particles
MICAL-like 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000114366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174850.2-2326s1c1
Sequence:CCGGGCCTTGATGTTTCAGCTGATTCTCGAGAATCAGCTGAAACATCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174850.2-910s1c1
Sequence:CCGGCGGAACTTAAGCCACCATCTACTCGAGTAGATGGTGGCTTAAGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174850.2-1806s1c1
Sequence:CCGGCCCAAGAATGAAGTGCCACAACTCGAGTTGTGGCACTTCATTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174850.2-2855s1c1
Sequence:CCGGCCGAAGTGACATCGTTGACTTCTCGAGAAGTCAACGATGTCACTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)