EMAIL THIS PAGE TO A FRIEND

MICB

MHC class I polypeptide-related sequence B

60 Gene Product Result for
Synonyms: PERB11.2
Gene ID:
Human(4277) Summary: This gene encodes a heavily glycosylated protein which is a ligand for the NKG2D type II receptor. Binding of the ligand activates the cytolytic response of natural killer (NK) cells, CD8 alphabeta T cells, and gammadelta T cells which express the receptor. This protein is stress-induced and is similar to MHC class I molecules; however, it does not associate with beta-2-microglobulin or bind peptides. [provided by RefSeq, Jul 2008]
Rat(365212) MHC class I polypeptide-related sequence B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005931 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005931 Rosetta Predictions human pricing
NM_001017468 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161375 predicted 1016
2 SASI_Hs01_00161376 predicted 591
3 SASI_Hs01_00161377 predicted 596
4 SASI_Hs01_00161378 predicted 918
5 SASI_Hs01_00161379 predicted 1040
6 SASI_Hs01_00161380 predicted 752
7 SASI_Hs01_00161381 predicted 1028
8 SASI_Hs01_00161382 predicted 607
9 SASI_Hs01_00161383 predicted 676
10 SASI_Hs02_00340587 predicted 1012
11 SASI_Hs01_00161384 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110942 predicted 372
2 SASI_Rn01_00110944 predicted 870
3 SASI_Rn01_00110946 predicted 961
4 SASI_Rn01_00110947 predicted 559
5 SASI_Rn01_00110950 predicted 898
6 SASI_Rn02_00202270 predicted 931
7 SASI_Rn02_00202271 predicted 670
8 SASI_Rn02_00202272 predicted 773
9 SASI_Rn02_00202273 predicted 356
10 SASI_Rn02_00202274 predicted 889
11 SASI_Rn01_00110941 predicted 1082
12 SASI_Rn01_00110943 predicted 342
13 SASI_Rn01_00110945 predicted 1178
14 SASI_Rn01_00110948 predicted 1140
15 SASI_Rn01_00110949 predicted 879
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005931
VALIDATED
MICB MISSION shRNA Bacterial Glycerol Stock
MHC class I polypeptide-related sequence B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005931.2-484s1c1
Sequence:CCGGCCTTGGCTATGAACGTCACAACTCGAGTTGTGACGTTCATAGCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005931.2-915s1c1
Sequence:CCGGCAGAGTCAACGGACAGACTTTCTCGAGAAAGTCTGTCCGTTGACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005931.2-983s1c1
Sequence:CCGGCTGTGTCCCTTGTTGCAAGAACTCGAGTTCTTGCAACAAGGGACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005931.2-924s1c1
Sequence:CCGGCGGACAGACTTTCCATATGTTCTCGAGAACATATGGAAAGTCTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005931.2-261s1c1
Sequence:CCGGACCGAGGACTTGACAGAGAATCTCGAGATTCTCTGTCAAGTCCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005931.3-1094s21c1
Sequence:CCGGCTGTGTCCCTTGTTGCAAGAACTCGAGTTCTTGCAACAAGGGACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005931.3-681s21c1
Sequence:CCGGCAGAAACTACAGCGATATCTGCTCGAGCAGATATCGCTGTAGTTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005931.3-1692s21c1
Sequence:CCGGGCTATCTCCTATACCAATAAACTCGAGTTTATTGGTATAGGAGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005931.3-1035s21c1
Sequence:CCGGCGGACAGACTTTCCATATGTTCTCGAGAACATATGGAAAGTCTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005931.3-1197s21c1
Sequence:CCGGGATGCAGCACAGCTGGGATTTCTCGAGAAATCCCAGCTGTGCTGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005931
VALIDATED
MICB MISSION shRNA shRNA Plasmid DNA
MHC class I polypeptide-related sequence B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005931.2-484s1c1
Sequence:CCGGCCTTGGCTATGAACGTCACAACTCGAGTTGTGACGTTCATAGCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005931.2-915s1c1
Sequence:CCGGCAGAGTCAACGGACAGACTTTCTCGAGAAAGTCTGTCCGTTGACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005931.2-983s1c1
Sequence:CCGGCTGTGTCCCTTGTTGCAAGAACTCGAGTTCTTGCAACAAGGGACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005931.2-924s1c1
Sequence:CCGGCGGACAGACTTTCCATATGTTCTCGAGAACATATGGAAAGTCTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005931.2-261s1c1
Sequence:CCGGACCGAGGACTTGACAGAGAATCTCGAGATTCTCTGTCAAGTCCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005931.3-1094s21c1
Sequence:CCGGCTGTGTCCCTTGTTGCAAGAACTCGAGTTCTTGCAACAAGGGACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005931.3-681s21c1
Sequence:CCGGCAGAAACTACAGCGATATCTGCTCGAGCAGATATCGCTGTAGTTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005931.3-1692s21c1
Sequence:CCGGGCTATCTCCTATACCAATAAACTCGAGTTTATTGGTATAGGAGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005931.3-1035s21c1
Sequence:CCGGCGGACAGACTTTCCATATGTTCTCGAGAACATATGGAAAGTCTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005931.3-1197s21c1
Sequence:CCGGGATGCAGCACAGCTGGGATTTCTCGAGAAATCCCAGCTGTGCTGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005931
VALIDATED
MICB MISSION shRNA Lentiviral Transduction Particles
MHC class I polypeptide-related sequence B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005931.2-484s1c1
Sequence:CCGGCCTTGGCTATGAACGTCACAACTCGAGTTGTGACGTTCATAGCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005931.2-915s1c1
Sequence:CCGGCAGAGTCAACGGACAGACTTTCTCGAGAAAGTCTGTCCGTTGACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005931.2-983s1c1
Sequence:CCGGCTGTGTCCCTTGTTGCAAGAACTCGAGTTCTTGCAACAAGGGACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005931.2-924s1c1
Sequence:CCGGCGGACAGACTTTCCATATGTTCTCGAGAACATATGGAAAGTCTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005931.2-261s1c1
Sequence:CCGGACCGAGGACTTGACAGAGAATCTCGAGATTCTCTGTCAAGTCCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005931.3-1094s21c1
Sequence:CCGGCTGTGTCCCTTGTTGCAAGAACTCGAGTTCTTGCAACAAGGGACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005931.3-681s21c1
Sequence:CCGGCAGAAACTACAGCGATATCTGCTCGAGCAGATATCGCTGTAGTTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005931.3-1692s21c1
Sequence:CCGGGCTATCTCCTATACCAATAAACTCGAGTTTATTGGTATAGGAGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005931.3-1035s21c1
Sequence:CCGGCGGACAGACTTTCCATATGTTCTCGAGAACATATGGAAAGTCTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005931.3-1197s21c1
Sequence:CCGGGATGCAGCACAGCTGGGATTTCTCGAGAAATCCCAGCTGTGCTGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)