EMAIL THIS PAGE TO A FRIEND

MICU2

mitochondrial calcium uptake 2

60 Gene Product Result for
Synonyms: 1110008L20Rik EFHA1
UniProtKB ID: Q8IYU8, Q8N0T6, Q8NAX8
Gene ID:
Mouse(68514) mitochondrial calcium uptake 2
Rat(171433) mitochondrial calcium uptake 2
naked mole-rat(101702226) mitochondrial calcium uptake 2
domestic guinea pig(100716577) mitochondrial calcium uptake 2
Zebrafish(548335) mitochondrial calcium uptake 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152726 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028643 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028643 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028643 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152726 Rosetta Predictions human pricing
NM_134396 Rosetta Predictions rat pricing
NM_028643 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106267 predicted 386
2 SASI_Hs02_00366632 predicted 1330
3 SASI_Hs01_00106268 predicted 715
4 SASI_Hs01_00106269 predicted 1338
5 SASI_Hs01_00106271 predicted 488
6 SASI_Hs02_00366633 predicted 953
7 SASI_Hs01_00106273 predicted 246
8 SASI_Hs01_00106274 predicted 1390
9 SASI_Hs01_00106275 predicted 1033
10 SASI_Hs01_00106276 predicted 308
11 SASI_Hs01_00106270 predicted 1229
12 SASI_Hs01_00106272 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134396 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070410 predicted 236
2 SASI_Rn02_00267965 predicted 788
3 SASI_Rn01_00070413 predicted 320
4 SASI_Rn02_00267966 predicted 1384
5 SASI_Rn02_00267967 predicted 467
6 SASI_Rn02_00267968 predicted 1011
7 SASI_Rn02_00267969 predicted 636
8 SASI_Rn02_00267970 predicted 920
9 SASI_Rn02_00267971 predicted 610
10 SASI_Rn02_00267972 predicted 735
11 SASI_Rn01_00070411 predicted 1550
12 SASI_Rn01_00070412 predicted 466
13 SASI_Rn01_00070414 predicted 1000
14 SASI_Rn01_00070415 predicted 1221
15 SASI_Rn01_00070416 predicted 254
16 SASI_Rn01_00070417 predicted 983
17 SASI_Rn01_00070418 predicted 1365
18 SASI_Rn01_00070419 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151342 predicted 256
2 SASI_Mm01_00151344 predicted 1014
3 SASI_Mm01_00151345 predicted 1559
4 SASI_Mm01_00151346 predicted 477
5 SASI_Mm02_00334157 predicted 1365
6 SASI_Mm01_00151347 predicted 1397
7 SASI_Mm02_00334158 predicted 996
8 SASI_Mm01_00151348 predicted 1232
9 SASI_Mm01_00151349 predicted 270
10 SASI_Mm01_00151350 predicted 989
11 SASI_Mm01_00151343 predicted 1413
12 SASI_Mm01_00151351 predicted 1265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152726
VALIDATED
MICU2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial calcium uptake 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152726.1-1022s1c1
Sequence:CCGGGCCATGCAGATGTTCAGTTTACTCGAGTAAACTGAACATCTGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152726.1-306s1c1
Sequence:CCGGCACTCGAACATGAAGGAGAATCTCGAGATTCTCCTTCATGTTCGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152726.1-955s1c1
Sequence:CCGGGAGCATTAGTTTGGATGAATTCTCGAGAATTCATCCAAACTAATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152726.1-619s1c1
Sequence:CCGGGCTGCAGAAGATCATAAGTAACTCGAGTTACTTATGATCTTCTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152726.1-490s1c1
Sequence:CCGGGCTAATTTCATATACCGAGTACTCGAGTACTCGGTATATGAAATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152726.1-1022s21c1
Sequence:CCGGGCCATGCAGATGTTCAGTTTACTCGAGTAAACTGAACATCTGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152726.1-1053s21c1
Sequence:CCGGCTGTCAGACTAGCGGAGTTTACTCGAGTAAACTCCGCTAGTCTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152726.1-619s21c1
Sequence:CCGGGCTGCAGAAGATCATAAGTAACTCGAGTTACTTATGATCTTCTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152726.1-955s21c1
Sequence:CCGGGAGCATTAGTTTGGATGAATTCTCGAGAATTCATCCAAACTAATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152726.1-1452s21c1
Sequence:CCGGTACTTGCTTTCTGATTCATAACTCGAGTTATGAATCAGAAAGCAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152726
VALIDATED
MICU2 MISSION shRNA shRNA Plasmid DNA
mitochondrial calcium uptake 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152726.1-1022s1c1
Sequence:CCGGGCCATGCAGATGTTCAGTTTACTCGAGTAAACTGAACATCTGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152726.1-306s1c1
Sequence:CCGGCACTCGAACATGAAGGAGAATCTCGAGATTCTCCTTCATGTTCGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152726.1-955s1c1
Sequence:CCGGGAGCATTAGTTTGGATGAATTCTCGAGAATTCATCCAAACTAATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152726.1-619s1c1
Sequence:CCGGGCTGCAGAAGATCATAAGTAACTCGAGTTACTTATGATCTTCTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152726.1-490s1c1
Sequence:CCGGGCTAATTTCATATACCGAGTACTCGAGTACTCGGTATATGAAATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152726.1-1022s21c1
Sequence:CCGGGCCATGCAGATGTTCAGTTTACTCGAGTAAACTGAACATCTGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152726.1-1053s21c1
Sequence:CCGGCTGTCAGACTAGCGGAGTTTACTCGAGTAAACTCCGCTAGTCTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152726.1-619s21c1
Sequence:CCGGGCTGCAGAAGATCATAAGTAACTCGAGTTACTTATGATCTTCTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152726.1-955s21c1
Sequence:CCGGGAGCATTAGTTTGGATGAATTCTCGAGAATTCATCCAAACTAATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152726.1-1452s21c1
Sequence:CCGGTACTTGCTTTCTGATTCATAACTCGAGTTATGAATCAGAAAGCAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152726
VALIDATED
MICU2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial calcium uptake 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152726.1-1022s1c1
Sequence:CCGGGCCATGCAGATGTTCAGTTTACTCGAGTAAACTGAACATCTGCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152726.1-306s1c1
Sequence:CCGGCACTCGAACATGAAGGAGAATCTCGAGATTCTCCTTCATGTTCGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152726.1-955s1c1
Sequence:CCGGGAGCATTAGTTTGGATGAATTCTCGAGAATTCATCCAAACTAATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152726.1-619s1c1
Sequence:CCGGGCTGCAGAAGATCATAAGTAACTCGAGTTACTTATGATCTTCTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152726.1-490s1c1
Sequence:CCGGGCTAATTTCATATACCGAGTACTCGAGTACTCGGTATATGAAATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152726.1-1022s21c1
Sequence:CCGGGCCATGCAGATGTTCAGTTTACTCGAGTAAACTGAACATCTGCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152726.1-1053s21c1
Sequence:CCGGCTGTCAGACTAGCGGAGTTTACTCGAGTAAACTCCGCTAGTCTGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152726.1-619s21c1
Sequence:CCGGGCTGCAGAAGATCATAAGTAACTCGAGTTACTTATGATCTTCTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152726.1-955s21c1
Sequence:CCGGGAGCATTAGTTTGGATGAATTCTCGAGAATTCATCCAAACTAATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152726.1-1452s21c1
Sequence:CCGGTACTTGCTTTCTGATTCATAACTCGAGTTATGAATCAGAAAGCAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028643
VALIDATED
MICU2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial calcium uptake 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028643.1-1829s1c1
Sequence:CCGGCCTGCCTTGAAATAGCACATACTCGAGTATGTGCTATTTCAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028643.1-412s1c1
Sequence:CCGGCGAGGATGTACTGTCAGGAATCTCGAGATTCCTGACAGTACATCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028643.1-614s1c1
Sequence:CCGGCTGCAGAAGATCATAAGTAAACTCGAGTTTACTTATGATCTTCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028643.1-1015s1c1
Sequence:CCGGCGCCATGCAAATGTTTAGTTTCTCGAGAAACTAAACATTTGCATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028643.1-1016s1c1
Sequence:CCGGGCCATGCAAATGTTTAGTTTACTCGAGTAAACTAAACATTTGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028643
VALIDATED
MICU2 MISSION shRNA shRNA Plasmid DNA
mitochondrial calcium uptake 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028643.1-1829s1c1
Sequence:CCGGCCTGCCTTGAAATAGCACATACTCGAGTATGTGCTATTTCAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028643.1-412s1c1
Sequence:CCGGCGAGGATGTACTGTCAGGAATCTCGAGATTCCTGACAGTACATCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028643.1-614s1c1
Sequence:CCGGCTGCAGAAGATCATAAGTAAACTCGAGTTTACTTATGATCTTCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028643.1-1015s1c1
Sequence:CCGGCGCCATGCAAATGTTTAGTTTCTCGAGAAACTAAACATTTGCATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028643.1-1016s1c1
Sequence:CCGGGCCATGCAAATGTTTAGTTTACTCGAGTAAACTAAACATTTGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028643
VALIDATED
MICU2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial calcium uptake 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028643.1-1829s1c1
Sequence:CCGGCCTGCCTTGAAATAGCACATACTCGAGTATGTGCTATTTCAAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028643.1-412s1c1
Sequence:CCGGCGAGGATGTACTGTCAGGAATCTCGAGATTCCTGACAGTACATCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028643.1-614s1c1
Sequence:CCGGCTGCAGAAGATCATAAGTAAACTCGAGTTTACTTATGATCTTCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028643.1-1015s1c1
Sequence:CCGGCGCCATGCAAATGTTTAGTTTCTCGAGAAACTAAACATTTGCATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028643.1-1016s1c1
Sequence:CCGGGCCATGCAAATGTTTAGTTTACTCGAGTAAACTAAACATTTGCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)