EMAIL THIS PAGE TO A FRIEND

MICU3

mitochondrial calcium uptake family, member 3

149 Gene Product Result for
Synonyms: EFHA2
UniProtKB ID: Q86XE3, Q8IYZ3
Gene ID:
Mouse(78506) mitochondrial calcium uptake family, member 3
Rat(364601) mitochondrial calcium uptake family, member 3
domestic guinea pig(100733123) mitochondrial calcium uptake family, member 3
naked mole-rat(101701384) mitochondrial calcium uptake family, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030110 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030110 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030110 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181723 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181723 Rosetta Predictions human pricing
XM_001065080 Rosetta Predictions rat pricing
XM_344525 Rosetta Predictions rat pricing
XM_001473089 Rosetta Predictions mouse pricing
XM_357872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040707 predicted 585
2 SASI_Hs01_00040708 predicted 1490
3 SASI_Hs01_00040710 predicted 1493
4 SASI_Hs01_00040711 predicted 1463
5 SASI_Hs01_00040712 predicted 1417
6 SASI_Hs01_00040713 predicted 480
7 SASI_Hs01_00040714 predicted 1180
8 SASI_Hs01_00040715 predicted 1123
9 SASI_Hs01_00040716 predicted 1614
10 SASI_Hs02_00370332 predicted 519
11 SASI_Hs01_00040709 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312775 predicted 1339
2 SASI_Rn02_00312776 predicted 1314
3 SASI_Rn02_00312777 predicted 1396
4 SASI_Rn02_00312778 predicted 1533
5 SASI_Rn02_00312779 predicted 1182
6 SASI_Rn02_00312780 predicted 474
7 SASI_Rn02_00312781 predicted 471
8 SASI_Rn02_00312782 predicted 1298
9 SASI_Rn02_00312783 predicted 1452
10 SASI_Rn02_00312784 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397230 predicted 1335
2 SASI_Rn02_00397231 predicted 906
3 SASI_Rn02_00397232 predicted 868
4 SASI_Rn02_00397233 predicted 1397
5 SASI_Rn02_00397234 predicted 1533
6 SASI_Rn02_00397235 predicted 471
7 SASI_Rn02_00397236 predicted 1301
8 SASI_Rn02_00397237 predicted 1454
9 SASI_Rn02_00397238 predicted 713
10 SASI_Rn02_00397239 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00365901 predicted 1294
2 SASI_Mm02_00365902 predicted 525
3 SASI_Mm02_00365903 predicted 1375
4 SASI_Mm02_00365904 predicted 1152
5 SASI_Mm02_00365905 predicted 1239
6 SASI_Mm02_00365906 predicted 1280
7 SASI_Mm02_00365907 predicted 1294
8 SASI_Mm02_00365908 predicted 454
9 SASI_Mm02_00365909 predicted 1063
10 SASI_Mm02_00365910 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_357872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426198 predicted 1077
2 SASI_Mm01_00225951 predicted 1302
3 SASI_Mm01_00225952 predicted 1374
4 SASI_Mm02_00426199 predicted 1146
5 SASI_Mm01_00225954 predicted 1277
6 SASI_Mm01_00225955 predicted 1289
7 SASI_Mm02_00426200 predicted 1060
8 SASI_Mm02_00426201 predicted 1117
9 SASI_Mm02_00426202 predicted 1425
10 SASI_Mm02_00426203 predicted 1318
11 SASI_Mm01_00225947 predicted 222
12 SASI_Mm01_00225948 predicted 218
13 SASI_Mm01_00225949 predicted 212
14 SASI_Mm01_00225950 predicted 213
15 SASI_Mm01_00225953 predicted 299
16 SASI_Mm01_00225956 predicted 119
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030110
VALIDATED
MICU3 MISSION shRNA Bacterial Glycerol Stock
mitochondrial calcium uptake family, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030110.1-844s21c1
Sequence:CCGGGGATACCATTCTCCTACTAATCTCGAGATTAGTAGGAGAATGGTATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030110.1-1102s21c1
Sequence:CCGGGAATTTCTTTCCTACTCTAATCTCGAGATTAGAGTAGGAAAGAAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030110.1-1154s21c1
Sequence:CCGGCCCATATTCTCCTGCGGTATACTCGAGTATACCGCAGGAGAATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030110.1-2038s21c1
Sequence:CCGGGATTTGTCCTGGGCCCTTAAACTCGAGTTTAAGGGCCCAGGACAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030110.1-425s21c1
Sequence:CCGGTTCGTTTATTTGCATCTATAGCTCGAGCTATAGATGCAAATAAACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030110
VALIDATED
MICU3 MISSION shRNA shRNA Plasmid DNA
mitochondrial calcium uptake family, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030110.1-844s21c1
Sequence:CCGGGGATACCATTCTCCTACTAATCTCGAGATTAGTAGGAGAATGGTATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030110.1-1102s21c1
Sequence:CCGGGAATTTCTTTCCTACTCTAATCTCGAGATTAGAGTAGGAAAGAAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030110.1-1154s21c1
Sequence:CCGGCCCATATTCTCCTGCGGTATACTCGAGTATACCGCAGGAGAATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030110.1-2038s21c1
Sequence:CCGGGATTTGTCCTGGGCCCTTAAACTCGAGTTTAAGGGCCCAGGACAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030110.1-425s21c1
Sequence:CCGGTTCGTTTATTTGCATCTATAGCTCGAGCTATAGATGCAAATAAACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030110
VALIDATED
MICU3 MISSION shRNA Lentiviral Transduction Particles
mitochondrial calcium uptake family, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030110.1-844s21c1
Sequence:CCGGGGATACCATTCTCCTACTAATCTCGAGATTAGTAGGAGAATGGTATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030110.1-1102s21c1
Sequence:CCGGGAATTTCTTTCCTACTCTAATCTCGAGATTAGAGTAGGAAAGAAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030110.1-1154s21c1
Sequence:CCGGCCCATATTCTCCTGCGGTATACTCGAGTATACCGCAGGAGAATATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030110.1-2038s21c1
Sequence:CCGGGATTTGTCCTGGGCCCTTAAACTCGAGTTTAAGGGCCCAGGACAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030110.1-425s21c1
Sequence:CCGGTTCGTTTATTTGCATCTATAGCTCGAGCTATAGATGCAAATAAACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181723
MICU3 MISSION shRNA Bacterial Glycerol Stock
mitochondrial calcium uptake family, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181723.1-1365s1c1
Sequence:CCGGGCCCTGAATATGTATAACTTTCTCGAGAAAGTTATACATATTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181723.1-946s1c1
Sequence:CCGGCTGAGGAACTTGTCTCCAGAACTCGAGTTCTGGAGACAAGTTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181723.1-1275s1c1
Sequence:CCGGCGTTACAGTATACCTGAAGAACTCGAGTTCTTCAGGTATACTGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181723.1-658s1c1
Sequence:CCGGCGAAGCTATTTCGAAATCTTACTCGAGTAAGATTTCGAAATAGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181723.1-518s1c1
Sequence:CCGGGCAGTTATTCATGACTCCGTACTCGAGTACGGAGTCATGAATAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181723
MICU3 MISSION shRNA shRNA Plasmid DNA
mitochondrial calcium uptake family, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181723.1-1365s1c1
Sequence:CCGGGCCCTGAATATGTATAACTTTCTCGAGAAAGTTATACATATTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181723.1-946s1c1
Sequence:CCGGCTGAGGAACTTGTCTCCAGAACTCGAGTTCTGGAGACAAGTTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181723.1-1275s1c1
Sequence:CCGGCGTTACAGTATACCTGAAGAACTCGAGTTCTTCAGGTATACTGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181723.1-658s1c1
Sequence:CCGGCGAAGCTATTTCGAAATCTTACTCGAGTAAGATTTCGAAATAGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181723.1-518s1c1
Sequence:CCGGGCAGTTATTCATGACTCCGTACTCGAGTACGGAGTCATGAATAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181723
MICU3 MISSION shRNA Lentiviral Transduction Particles
mitochondrial calcium uptake family, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181723.1-1365s1c1
Sequence:CCGGGCCCTGAATATGTATAACTTTCTCGAGAAAGTTATACATATTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181723.1-946s1c1
Sequence:CCGGCTGAGGAACTTGTCTCCAGAACTCGAGTTCTGGAGACAAGTTCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181723.1-1275s1c1
Sequence:CCGGCGTTACAGTATACCTGAAGAACTCGAGTTCTTCAGGTATACTGTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181723.1-658s1c1
Sequence:CCGGCGAAGCTATTTCGAAATCTTACTCGAGTAAGATTTCGAAATAGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181723.1-518s1c1
Sequence:CCGGGCAGTTATTCATGACTCCGTACTCGAGTACGGAGTCATGAATAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)