EMAIL THIS PAGE TO A FRIEND

MID1

midline 1 (Opitz/BBB syndrome)

148 Gene Product Result for
Synonyms: BBBG1 FXY GBBB1 MIDIN OGS1 OS OSX RNF59 TRIM18 XPRF ZNFXY
UniProtKB ID: O15344, B2RCG2, O75361, Q9BZX5
Gene ID:
Human(4281) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein forms homodimers which associate with microtubules in the cytoplasm. The protein is likely involved in the formation of multiprotein structures acting as anchor points to microtubules. Mutations in this gene have been associated with the X-linked form of Opitz syndrome, which is characterized by midline abnormalities such as cleft lip, laryngeal cleft, heart defects, hypospadias, and agenesis of the corpus callosum. This gene was also the first example of a gene subject to X inactivation in human while escaping it in mouse. Multiple different transcript variants are generated by alternate splicing; however, the full-length nature of some of the variants has not been determined. [provided by RefSeq, Jul 2010]
Mouse(17318) midline 1
Rat(54252) midline 1 (Opitz/BBB syndrome)
Zebrafish(100330952) midline 1 (Opitz/BBB syndrome)
cow(534604) midline 1 (Opitz/BBB syndrome)
Horse(100049999) midline 1 (Opitz/BBB syndrome)
domestic cat(101085021) midline 1 (Opitz/BBB syndrome)
dog(491737) midline 1 (Opitz/BBB syndrome)
chicken(373920) midline 1 (Opitz/BBB syndrome)
naked mole-rat(101701977) midline 1 (Opitz/BBB syndrome)
domestic guinea pig(100716416) midline 1 (Opitz/BBB syndrome)
sheep(101117818) midline 1 (Opitz/BBB syndrome)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010797 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010797 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010797 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000381 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000381 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000381 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014801 MISSION® esiRNA esiRNA targeting human MID1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000381 Rosetta Predictions human pricing
NM_001098624 Rosetta Predictions human pricing
NM_033290 Rosetta Predictions human pricing
NM_033291 Rosetta Predictions human pricing
NM_022927 Rosetta Predictions rat pricing
NM_010797 Rosetta Predictions mouse pricing
NM_183151 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081324 predicted 1678
2 SASI_Hs01_00081325 predicted 1459
3 SASI_Hs01_00081326 predicted 1764
4 SASI_Hs02_00302447 predicted 1900
5 SASI_Hs02_00302448 predicted 1862
6 SASI_Hs01_00081327 predicted 789
7 SASI_Hs02_00302449 predicted 2059
8 SASI_Hs01_00081332 predicted 1068
9 SASI_Hs01_00081333 predicted 1446
10 SASI_Hs02_00302450 predicted 842
11 SASI_Hs01_00081328 predicted 2222
12 SASI_Hs01_00081329 predicted 835
13 SASI_Hs01_00081330 predicted 1303
14 SASI_Hs01_00081331 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319546 predicted 1601
2 SASI_Hs02_00319547 predicted 1391
3 SASI_Hs02_00319548 predicted 1698
4 SASI_Hs02_00319549 predicted 1829
5 SASI_Hs02_00319550 predicted 1799
6 SASI_Hs02_00319551 predicted 720
7 SASI_Hs02_00319552 predicted 1988
8 SASI_Hs02_00319553 predicted 996
9 SASI_Hs02_00319554 predicted 1378
10 SASI_Hs02_00319555 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096304 predicted 1462
2 SASI_Hs01_00096305 predicted 1249
3 SASI_Hs01_00096306 predicted 1559
4 SASI_Hs02_00361098 predicted 1687
5 SASI_Hs02_00361099 predicted 1661
6 SASI_Hs01_00096307 predicted 578
7 SASI_Hs02_00361100 predicted 1853
8 SASI_Hs01_00096312 predicted 857
9 SASI_Hs01_00096313 predicted 1242
10 SASI_Hs02_00361101 predicted 642
11 SASI_Hs01_00096308 predicted 2164
12 SASI_Hs01_00096309 predicted 766
13 SASI_Hs01_00096310 predicted 1244
14 SASI_Hs01_00096311 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056264 predicted 1463
2 SASI_Hs01_00056265 predicted 1479
3 SASI_Hs01_00056266 predicted 1247
4 SASI_Hs01_00056267 predicted 1554
5 SASI_Hs01_00056268 predicted 581
6 SASI_Hs01_00056269 predicted 827
7 SASI_Hs01_00056270 predicted 1311
8 SASI_Hs01_00056271 predicted 1170
9 SASI_Hs01_00056272 predicted 853
10 SASI_Hs01_00056273 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087191 predicted 1586
2 SASI_Rn02_00263620 predicted 1141
3 SASI_Rn01_00087192 predicted 1291
4 SASI_Rn01_00087193 predicted 1673
5 SASI_Rn01_00087194 predicted 1694
6 SASI_Rn01_00087195 predicted 1265
7 SASI_Rn01_00087196 predicted 899
8 SASI_Rn01_00087197 predicted 1051
9 SASI_Rn01_00087198 predicted 903
10 SASI_Rn01_00087199 predicted 262
11 SASI_Rn01_00087200 predicted 1528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010797 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089696 predicted 1057
2 SASI_Mm01_00089697 predicted 852
3 SASI_Mm01_00089698 predicted 1216
4 SASI_Mm01_00089699 predicted 566
5 SASI_Mm01_00089701 predicted 855
6 SASI_Mm01_00089703 predicted 919
7 SASI_Mm02_00319367 predicted 822
8 SASI_Mm01_00089704 predicted 609
9 SASI_Mm01_00089705 predicted 641
10 SASI_Mm02_00319368 predicted 1669
11 SASI_Mm01_00089700 predicted 1051
12 SASI_Mm01_00089702 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350197 predicted 1219
2 SASI_Mm02_00350198 predicted 1009
3 SASI_Mm02_00350199 predicted 1376
4 SASI_Mm02_00350200 predicted 734
5 SASI_Mm02_00350201 predicted 1017
6 SASI_Mm02_00350202 predicted 1081
7 SASI_Mm02_00350203 predicted 980
8 SASI_Mm02_00350204 predicted 775
9 SASI_Mm02_00350205 predicted 807
10 SASI_Mm02_00350206 predicted 1829
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010797
MID1 MISSION shRNA Bacterial Glycerol Stock
midline 1 (Opitz/BBB syndrome)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010797.2-1000s21c1
Sequence:CCGGTTCAGCAACGAAGACAAATTACTCGAGTAATTTGTCTTCGTTGCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010797.2-1048s21c1
Sequence:CCGGTGATCAGGCTCCGCAAGTTAGCTCGAGCTAACTTGCGGAGCCTGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010797.2-2937s21c1
Sequence:CCGGAGCCGTCTTGAGCCTAATAAGCTCGAGCTTATTAGGCTCAAGACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010797.1-1867s1c1
Sequence:CCGGCGGAAGCACATGGTACGCCATCTCGAGATGGCGTACCATGTGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010797.1-1222s1c1
Sequence:CCGGCCAGGTCCTAATTCCCGAAATCTCGAGATTTCGGGAATTAGGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010797.2-977s21c1
Sequence:CCGGATGTGATCTTCTCATTGAAATCTCGAGATTTCAATGAGAAGATCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010797.2-1661s21c1
Sequence:CCGGGACCAACAGTCAGCCGTTTAGCTCGAGCTAAACGGCTGACTGTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010797.1-213s1c1
Sequence:CCGGGTCCTATTTGTCTGGAGCTTTCTCGAGAAAGCTCCAGACAAATAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010797.1-1594s1c1
Sequence:CCGGCAAGTATATCTTCACGGTGAACTCGAGTTCACCGTGAAGATATACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010797.1-632s1c1
Sequence:CCGGCATCCGAACAAGAAGCCCTTTCTCGAGAAAGGGCTTCTTGTTCGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010797
MID1 MISSION shRNA shRNA Plasmid DNA
midline 1 (Opitz/BBB syndrome)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010797.2-1000s21c1
Sequence:CCGGTTCAGCAACGAAGACAAATTACTCGAGTAATTTGTCTTCGTTGCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010797.2-1048s21c1
Sequence:CCGGTGATCAGGCTCCGCAAGTTAGCTCGAGCTAACTTGCGGAGCCTGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010797.2-2937s21c1
Sequence:CCGGAGCCGTCTTGAGCCTAATAAGCTCGAGCTTATTAGGCTCAAGACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010797.1-1867s1c1
Sequence:CCGGCGGAAGCACATGGTACGCCATCTCGAGATGGCGTACCATGTGCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010797.1-1222s1c1
Sequence:CCGGCCAGGTCCTAATTCCCGAAATCTCGAGATTTCGGGAATTAGGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010797.2-977s21c1
Sequence:CCGGATGTGATCTTCTCATTGAAATCTCGAGATTTCAATGAGAAGATCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010797.2-1661s21c1
Sequence:CCGGGACCAACAGTCAGCCGTTTAGCTCGAGCTAAACGGCTGACTGTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010797.1-213s1c1
Sequence:CCGGGTCCTATTTGTCTGGAGCTTTCTCGAGAAAGCTCCAGACAAATAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010797.1-1594s1c1
Sequence:CCGGCAAGTATATCTTCACGGTGAACTCGAGTTCACCGTGAAGATATACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010797.1-632s1c1
Sequence:CCGGCATCCGAACAAGAAGCCCTTTCTCGAGAAAGGGCTTCTTGTTCGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010797
MID1 MISSION shRNA Lentiviral Transduction Particles
midline 1 (Opitz/BBB syndrome)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010797.2-1000s21c1
Sequence:CCGGTTCAGCAACGAAGACAAATTACTCGAGTAATTTGTCTTCGTTGCTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010797.2-1048s21c1
Sequence:CCGGTGATCAGGCTCCGCAAGTTAGCTCGAGCTAACTTGCGGAGCCTGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010797.2-2937s21c1
Sequence:CCGGAGCCGTCTTGAGCCTAATAAGCTCGAGCTTATTAGGCTCAAGACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010797.1-1867s1c1
Sequence:CCGGCGGAAGCACATGGTACGCCATCTCGAGATGGCGTACCATGTGCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010797.1-1222s1c1
Sequence:CCGGCCAGGTCCTAATTCCCGAAATCTCGAGATTTCGGGAATTAGGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010797.2-977s21c1
Sequence:CCGGATGTGATCTTCTCATTGAAATCTCGAGATTTCAATGAGAAGATCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010797.2-1661s21c1
Sequence:CCGGGACCAACAGTCAGCCGTTTAGCTCGAGCTAAACGGCTGACTGTTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010797.1-213s1c1
Sequence:CCGGGTCCTATTTGTCTGGAGCTTTCTCGAGAAAGCTCCAGACAAATAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010797.1-1594s1c1
Sequence:CCGGCAAGTATATCTTCACGGTGAACTCGAGTTCACCGTGAAGATATACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010797.1-632s1c1
Sequence:CCGGCATCCGAACAAGAAGCCCTTTCTCGAGAAAGGGCTTCTTGTTCGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000381
VALIDATED
MID1 MISSION shRNA Bacterial Glycerol Stock
midline 1 (Opitz/BBB syndrome)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000381.2-1075s21c1
Sequence:CCGGGTAACCTCACCAACCTTATTACTCGAGTAATAAGGTTGGTGAGGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_000381.2-962s21c1
Sequence:CCGGTGTGACCGATGACCAGTTAATCTCGAGATTAACTGGTCATCGGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000381.2-2333s21c1
Sequence:CCGGGAACAAGTGTCTGACGATTATCTCGAGATAATCGTCAGACACTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000381.1-1551s1c1
Sequence:CCGGCGGCACCAAGTACATCTTCATCTCGAGATGAAGATGTACTTGGTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000381.1-830s1c1
Sequence:CCGGGCTATGACAAATTGAAGCAAACTCGAGTTTGCTTCAATTTGTCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000381.2-2442s21c1
Sequence:CCGGTAAGGTTCAGGCCACTATTTACTCGAGTAAATAGTGGCCTGAACCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000381.1-1777s1c1
Sequence:CCGGGCTGGAAATGTGTTTATTGATCTCGAGATCAATAAACACATTTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000381.1-660s1c1
Sequence:CCGGCCATCGTCTGATTGAGCCAATCTCGAGATTGGCTCAATCAGACGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000381
VALIDATED
MID1 MISSION shRNA shRNA Plasmid DNA
midline 1 (Opitz/BBB syndrome)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000381.2-1075s21c1
Sequence:CCGGGTAACCTCACCAACCTTATTACTCGAGTAATAAGGTTGGTGAGGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_000381.2-962s21c1
Sequence:CCGGTGTGACCGATGACCAGTTAATCTCGAGATTAACTGGTCATCGGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000381.2-2333s21c1
Sequence:CCGGGAACAAGTGTCTGACGATTATCTCGAGATAATCGTCAGACACTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000381.1-1551s1c1
Sequence:CCGGCGGCACCAAGTACATCTTCATCTCGAGATGAAGATGTACTTGGTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000381.1-830s1c1
Sequence:CCGGGCTATGACAAATTGAAGCAAACTCGAGTTTGCTTCAATTTGTCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000381.2-2442s21c1
Sequence:CCGGTAAGGTTCAGGCCACTATTTACTCGAGTAAATAGTGGCCTGAACCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000381.1-1777s1c1
Sequence:CCGGGCTGGAAATGTGTTTATTGATCTCGAGATCAATAAACACATTTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000381.1-660s1c1
Sequence:CCGGCCATCGTCTGATTGAGCCAATCTCGAGATTGGCTCAATCAGACGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000381
VALIDATED
MID1 MISSION shRNA Lentiviral Transduction Particles
midline 1 (Opitz/BBB syndrome)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000381.2-1075s21c1
Sequence:CCGGGTAACCTCACCAACCTTATTACTCGAGTAATAAGGTTGGTGAGGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_000381.2-962s21c1
Sequence:CCGGTGTGACCGATGACCAGTTAATCTCGAGATTAACTGGTCATCGGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000381.2-2333s21c1
Sequence:CCGGGAACAAGTGTCTGACGATTATCTCGAGATAATCGTCAGACACTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000381.1-1551s1c1
Sequence:CCGGCGGCACCAAGTACATCTTCATCTCGAGATGAAGATGTACTTGGTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000381.1-830s1c1
Sequence:CCGGGCTATGACAAATTGAAGCAAACTCGAGTTTGCTTCAATTTGTCATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000381.2-2442s21c1
Sequence:CCGGTAAGGTTCAGGCCACTATTTACTCGAGTAAATAGTGGCCTGAACCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000381.1-1777s1c1
Sequence:CCGGGCTGGAAATGTGTTTATTGATCTCGAGATCAATAAACACATTTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000381.1-660s1c1
Sequence:CCGGCCATCGTCTGATTGAGCCAATCTCGAGATTGGCTCAATCAGACGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)