EMAIL THIS PAGE TO A FRIEND

MID2

midline 2

82 Gene Product Result for
Synonyms: FXY2 RNF60 TRIM1
UniProtKB ID: Q9UJV3, A6NEL8, A6PVI5, Q5JYF5, Q8WWK1, Q9UJR9
Gene ID:
Human(11043) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to microtubular structures in the cytoplasm. Alternate splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
Mouse(23947) midline 2
Rat(363502) midline 2
Zebrafish(799891) midline 2
chicken(422131) midline 2
dog(481012) midline 2
Horse(100054631) midline 2
sheep(101114170) midline 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012216 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011845 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011845 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011845 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012216 Rosetta Predictions human pricing
NM_052817 Rosetta Predictions human pricing
XM_001053301 Rosetta Predictions rat pricing
XM_343825 Rosetta Predictions rat pricing
NM_011845 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218289 predicted 1078
2 SASI_Hs01_00218290 predicted 1009
3 SASI_Hs01_00218291 predicted 1864
4 SASI_Hs01_00218292 predicted 595
5 SASI_Hs01_00218294 predicted 1143
6 SASI_Hs01_00218295 predicted 2086
7 SASI_Hs02_00343887 predicted 479
8 SASI_Hs01_00218296 predicted 2268
9 SASI_Hs01_00218297 predicted 807
10 SASI_Hs01_00218298 predicted 2006
11 SASI_Hs01_00218293 predicted 1997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220952 predicted 1084
2 SASI_Hs01_00220953 predicted 1012
3 SASI_Hs01_00220954 predicted 1778
4 SASI_Hs01_00220955 predicted 601
5 SASI_Hs01_00220957 predicted 1147
6 SASI_Hs01_00220958 predicted 1995
7 SASI_Hs02_00361492 predicted 477
8 SASI_Hs01_00220959 predicted 2179
9 SASI_Hs01_00220960 predicted 814
10 SASI_Hs01_00220961 predicted 1914
11 SASI_Hs01_00220956 predicted 1899
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271874 predicted 2652
2 SASI_Rn02_00271875 predicted 715
3 SASI_Rn02_00271876 predicted 2590
4 SASI_Rn02_00271877 predicted 1466
5 SASI_Rn02_00271878 predicted 1726
6 SASI_Rn02_00271879 predicted 883
7 SASI_Rn02_00271880 predicted 925
8 SASI_Rn02_00271881 predicted 1434
9 SASI_Rn02_00271882 predicted 2466
10 SASI_Rn02_00271883 predicted 2461
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396379 predicted 1625
2 SASI_Rn02_00396380 predicted 2474
3 SASI_Rn02_00396381 predicted 2415
4 SASI_Rn02_00396382 predicted 1287
5 SASI_Rn02_00396383 predicted 1547
6 SASI_Rn02_00396384 predicted 1825
7 SASI_Rn02_00396385 predicted 1248
8 SASI_Rn02_00396386 predicted 2281
9 SASI_Rn02_00396387 predicted 2273
10 SASI_Rn02_00396388 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144114 predicted 2075
2 SASI_Mm01_00144116 predicted 200
3 SASI_Mm01_00144117 predicted 364
4 SASI_Mm01_00144118 predicted 1209
5 SASI_Mm01_00144119 predicted 594
6 SASI_Mm01_00144120 predicted 2061
7 SASI_Mm01_00144121 predicted 2133
8 SASI_Mm01_00144122 predicted 1953
9 SASI_Mm01_00144123 predicted 1940
10 SASI_Mm02_00321579 predicted 953
11 SASI_Mm01_00144115 predicted 1719
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012216
VALIDATED
MID2 MISSION shRNA Bacterial Glycerol Stock
midline 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012216.2-1407s1c1
Sequence:CCGGCCACCATCTATCCGAGAAGAACTCGAGTTCTTCTCGGATAGATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_012216.2-2372s1c1
Sequence:CCGGCCCTTATGTTTCTGGGATGAACTCGAGTTCATCCCAGAAACATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_012216.2-599s1c1
Sequence:CCGGCGAGCGAATTGCTTGCCAATTCTCGAGAATTGGCAAGCAATTCGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012216.2-494s1c1
Sequence:CCGGGCAGAACATTATTGATCGCTTCTCGAGAAGCGATCAATAATGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012216.2-2165s1c1
Sequence:CCGGCCTCCTGGATTATGACAACAACTCGAGTTGTTGTCATAATCCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012216.3-2000s21c1
Sequence:CCGGCGCCACGAGGCCTGTATAATTCTCGAGAATTATACAGGCCTCGTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012216.3-665s21c1
Sequence:CCGGCAATCTGCCTAGAGTTGTTTGCTCGAGCAAACAACTCTAGGCAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012216.3-767s21c1
Sequence:CCGGGTGAATCCATTGAACCCATTACTCGAGTAATGGGTTCAATGGATTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012216.3-2779s21c1
Sequence:CCGGTAAGTTTCAGGAGAGTATATACTCGAGTATATACTCTCCTGAAACTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012216.3-2839s21c1
Sequence:CCGGCACCTAAGTTAGCGTTCAATACTCGAGTATTGAACGCTAACTTAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012216
VALIDATED
MID2 MISSION shRNA shRNA Plasmid DNA
midline 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012216.2-1407s1c1
Sequence:CCGGCCACCATCTATCCGAGAAGAACTCGAGTTCTTCTCGGATAGATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_012216.2-2372s1c1
Sequence:CCGGCCCTTATGTTTCTGGGATGAACTCGAGTTCATCCCAGAAACATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_012216.2-599s1c1
Sequence:CCGGCGAGCGAATTGCTTGCCAATTCTCGAGAATTGGCAAGCAATTCGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012216.2-494s1c1
Sequence:CCGGGCAGAACATTATTGATCGCTTCTCGAGAAGCGATCAATAATGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012216.2-2165s1c1
Sequence:CCGGCCTCCTGGATTATGACAACAACTCGAGTTGTTGTCATAATCCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012216.3-2000s21c1
Sequence:CCGGCGCCACGAGGCCTGTATAATTCTCGAGAATTATACAGGCCTCGTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012216.3-665s21c1
Sequence:CCGGCAATCTGCCTAGAGTTGTTTGCTCGAGCAAACAACTCTAGGCAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012216.3-767s21c1
Sequence:CCGGGTGAATCCATTGAACCCATTACTCGAGTAATGGGTTCAATGGATTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012216.3-2779s21c1
Sequence:CCGGTAAGTTTCAGGAGAGTATATACTCGAGTATATACTCTCCTGAAACTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012216.3-2839s21c1
Sequence:CCGGCACCTAAGTTAGCGTTCAATACTCGAGTATTGAACGCTAACTTAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012216
VALIDATED
MID2 MISSION shRNA Lentiviral Transduction Particles
midline 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012216.2-1407s1c1
Sequence:CCGGCCACCATCTATCCGAGAAGAACTCGAGTTCTTCTCGGATAGATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_012216.2-2372s1c1
Sequence:CCGGCCCTTATGTTTCTGGGATGAACTCGAGTTCATCCCAGAAACATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_012216.2-599s1c1
Sequence:CCGGCGAGCGAATTGCTTGCCAATTCTCGAGAATTGGCAAGCAATTCGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012216.2-494s1c1
Sequence:CCGGGCAGAACATTATTGATCGCTTCTCGAGAAGCGATCAATAATGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012216.2-2165s1c1
Sequence:CCGGCCTCCTGGATTATGACAACAACTCGAGTTGTTGTCATAATCCAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012216.3-2000s21c1
Sequence:CCGGCGCCACGAGGCCTGTATAATTCTCGAGAATTATACAGGCCTCGTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012216.3-665s21c1
Sequence:CCGGCAATCTGCCTAGAGTTGTTTGCTCGAGCAAACAACTCTAGGCAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012216.3-767s21c1
Sequence:CCGGGTGAATCCATTGAACCCATTACTCGAGTAATGGGTTCAATGGATTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012216.3-2779s21c1
Sequence:CCGGTAAGTTTCAGGAGAGTATATACTCGAGTATATACTCTCCTGAAACTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012216.3-2839s21c1
Sequence:CCGGCACCTAAGTTAGCGTTCAATACTCGAGTATTGAACGCTAACTTAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011845
MID2 MISSION shRNA Bacterial Glycerol Stock
midline 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011845.1-2494s1c1
Sequence:CCGGCCTCCATTAGTGCTCCATATACTCGAGTATATGGAGCACTAATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011845.1-1665s1c1
Sequence:CCGGGCCTGTACAATTCAGTGGATACTCGAGTATCCACTGAATTGTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011845.1-1325s1c1
Sequence:CCGGGCTGAGCATATCCTAAAGGAACTCGAGTTCCTTTAGGATATGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011845.1-1122s1c1
Sequence:CCGGGCCAGCAAGTTGAGGTGAATACTCGAGTATTCACCTCAACTTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011845.1-1751s1c1
Sequence:CCGGCGCTACATCTTTATCGTGAAACTCGAGTTTCACGATAAAGATGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011845.2-253s21c1
Sequence:CCGGGTGACCCTGCAGAACATTATTCTCGAGAATAATGTTCTGCAGGGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011845.2-1589s21c1
Sequence:CCGGTTAGTGGCACAGGGTGTTATGCTCGAGCATAACACCCTGTGCCACTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011845
MID2 MISSION shRNA shRNA Plasmid DNA
midline 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011845.1-2494s1c1
Sequence:CCGGCCTCCATTAGTGCTCCATATACTCGAGTATATGGAGCACTAATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011845.1-1665s1c1
Sequence:CCGGGCCTGTACAATTCAGTGGATACTCGAGTATCCACTGAATTGTACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011845.1-1325s1c1
Sequence:CCGGGCTGAGCATATCCTAAAGGAACTCGAGTTCCTTTAGGATATGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011845.1-1122s1c1
Sequence:CCGGGCCAGCAAGTTGAGGTGAATACTCGAGTATTCACCTCAACTTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011845.1-1751s1c1
Sequence:CCGGCGCTACATCTTTATCGTGAAACTCGAGTTTCACGATAAAGATGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011845.2-253s21c1
Sequence:CCGGGTGACCCTGCAGAACATTATTCTCGAGAATAATGTTCTGCAGGGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011845.2-1589s21c1
Sequence:CCGGTTAGTGGCACAGGGTGTTATGCTCGAGCATAACACCCTGTGCCACTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011845
MID2 MISSION shRNA Lentiviral Transduction Particles
midline 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011845.1-2494s1c1
Sequence:CCGGCCTCCATTAGTGCTCCATATACTCGAGTATATGGAGCACTAATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011845.1-1665s1c1
Sequence:CCGGGCCTGTACAATTCAGTGGATACTCGAGTATCCACTGAATTGTACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011845.1-1325s1c1
Sequence:CCGGGCTGAGCATATCCTAAAGGAACTCGAGTTCCTTTAGGATATGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011845.1-1122s1c1
Sequence:CCGGGCCAGCAAGTTGAGGTGAATACTCGAGTATTCACCTCAACTTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011845.1-1751s1c1
Sequence:CCGGCGCTACATCTTTATCGTGAAACTCGAGTTTCACGATAAAGATGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011845.2-253s21c1
Sequence:CCGGGTGACCCTGCAGAACATTATTCTCGAGAATAATGTTCTGCAGGGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011845.2-1589s21c1
Sequence:CCGGTTAGTGGCACAGGGTGTTATGCTCGAGCATAACACCCTGTGCCACTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)