EMAIL THIS PAGE TO A FRIEND

MIDN

midnolin

61 Gene Product Result for
UniProtKB ID: Q504T8, Q96BW8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177401 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177401 Rosetta Predictions human pricing
XM_001076784 Rosetta Predictions rat pricing
XM_234902 Rosetta Predictions rat pricing
NM_021565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074293 predicted 1310
2 SASI_Hs01_00074294 predicted 1315
3 SASI_Hs01_00074295 predicted 856
4 SASI_Hs01_00074296 predicted 902
5 SASI_Hs01_00074297 predicted 1708
6 SASI_Hs01_00074298 predicted 1680
7 SASI_Hs01_00074299 predicted 1312
8 SASI_Hs01_00074300 predicted 1143
9 SASI_Hs01_00074301 predicted 853
10 SASI_Hs01_00074302 predicted 2357
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076784 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354564 predicted 838
2 SASI_Rn02_00354565 predicted 593
3 SASI_Rn02_00354566 predicted 1445
4 SASI_Rn02_00354567 predicted 2043
5 SASI_Rn02_00354568 predicted 1902
6 SASI_Rn02_00354569 predicted 498
7 SASI_Rn02_00354570 predicted 1229
8 SASI_Rn02_00354571 predicted 1315
9 SASI_Rn02_00354572 predicted 498
10 SASI_Rn02_00354573 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388728 predicted 592
2 SASI_Rn02_00388729 predicted 495
3 SASI_Rn02_00388730 predicted 846
4 SASI_Rn02_00388731 predicted 497
5 SASI_Rn02_00388732 predicted 611
6 SASI_Rn02_00388733 predicted 982
7 SASI_Rn02_00388734 predicted 485
8 SASI_Rn02_00388735 predicted 954
9 SASI_Rn02_00388736 predicted 487
10 SASI_Rn02_00388737 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031537 predicted 1493
2 SASI_Mm01_00031538 predicted 1925
3 SASI_Mm01_00031539 predicted 1957
4 SASI_Mm01_00031540 predicted 881
5 SASI_Mm01_00031541 predicted 1371
6 SASI_Mm01_00031542 predicted 546
7 SASI_Mm01_00031543 predicted 1947
8 SASI_Mm01_00031544 predicted 605
9 SASI_Mm02_00326353 predicted 632
10 SASI_Mm02_00326354 predicted 2153
11 SASI_Mm01_00031545 predicted 640
12 SASI_Mm01_00031546 predicted 984
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177401
MIDN MISSION shRNA Bacterial Glycerol Stock
midnolin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177401.4-1879s1c1
Sequence:CCGGCAGAAGTCAACCCTGACATCACTCGAGTGATGTCAGGGTTGACTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177401.4-2369s1c1
Sequence:CCGGGTCATTATGCACTTTACAGATCTCGAGATCTGTAAAGTGCATAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177401.4-3309s1c1
Sequence:CCGGGTTAATGGTTTCAGATGTGAACTCGAGTTCACATCTGAAACCATTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177401.4-1890s1c1
Sequence:CCGGCCTGACATCAAGTCAGAGTTCCTCGAGGAACTCTGACTTGATGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177401.4-1319s1c1
Sequence:CCGGCATCGAGAGCTTTGTGAATCACTCGAGTGATTCACAAAGCTCTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177401.4-3322s1c1
Sequence:CCGGGATGTGAACATCACGTGTTATCTCGAGATAACACGTGATGTTCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177401.4-2517s1c1
Sequence:CCGGCTGTTTCTCTTCCACTCCTATCTCGAGATAGGAGTGGAAGAGAAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177401.4-1884s1c1
Sequence:CCGGGTCAACCCTGACATCAAGTCACTCGAGTGACTTGATGTCAGGGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177401.4-1889s1c1
Sequence:CCGGCCCTGACATCAAGTCAGAGTTCTCGAGAACTCTGACTTGATGTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177401
MIDN MISSION shRNA shRNA Plasmid DNA
midnolin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177401.4-1879s1c1
Sequence:CCGGCAGAAGTCAACCCTGACATCACTCGAGTGATGTCAGGGTTGACTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177401.4-2369s1c1
Sequence:CCGGGTCATTATGCACTTTACAGATCTCGAGATCTGTAAAGTGCATAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177401.4-3309s1c1
Sequence:CCGGGTTAATGGTTTCAGATGTGAACTCGAGTTCACATCTGAAACCATTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177401.4-1890s1c1
Sequence:CCGGCCTGACATCAAGTCAGAGTTCCTCGAGGAACTCTGACTTGATGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177401.4-1319s1c1
Sequence:CCGGCATCGAGAGCTTTGTGAATCACTCGAGTGATTCACAAAGCTCTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177401.4-3322s1c1
Sequence:CCGGGATGTGAACATCACGTGTTATCTCGAGATAACACGTGATGTTCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177401.4-2517s1c1
Sequence:CCGGCTGTTTCTCTTCCACTCCTATCTCGAGATAGGAGTGGAAGAGAAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177401.4-1884s1c1
Sequence:CCGGGTCAACCCTGACATCAAGTCACTCGAGTGACTTGATGTCAGGGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177401.4-1889s1c1
Sequence:CCGGCCCTGACATCAAGTCAGAGTTCTCGAGAACTCTGACTTGATGTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177401
MIDN MISSION shRNA Lentiviral Transduction Particles
midnolin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177401.4-1879s1c1
Sequence:CCGGCAGAAGTCAACCCTGACATCACTCGAGTGATGTCAGGGTTGACTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177401.4-2369s1c1
Sequence:CCGGGTCATTATGCACTTTACAGATCTCGAGATCTGTAAAGTGCATAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177401.4-3309s1c1
Sequence:CCGGGTTAATGGTTTCAGATGTGAACTCGAGTTCACATCTGAAACCATTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177401.4-1890s1c1
Sequence:CCGGCCTGACATCAAGTCAGAGTTCCTCGAGGAACTCTGACTTGATGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177401.4-1319s1c1
Sequence:CCGGCATCGAGAGCTTTGTGAATCACTCGAGTGATTCACAAAGCTCTCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177401.4-3322s1c1
Sequence:CCGGGATGTGAACATCACGTGTTATCTCGAGATAACACGTGATGTTCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177401.4-2517s1c1
Sequence:CCGGCTGTTTCTCTTCCACTCCTATCTCGAGATAGGAGTGGAAGAGAAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177401.4-1884s1c1
Sequence:CCGGGTCAACCCTGACATCAAGTCACTCGAGTGACTTGATGTCAGGGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177401.4-1889s1c1
Sequence:CCGGCCCTGACATCAAGTCAGAGTTCTCGAGAACTCTGACTTGATGTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021565
MIDN MISSION shRNA Bacterial Glycerol Stock
midnolin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021565.1-1964s21c1
Sequence:CCGGCCGAGTTTGTGGTGGCTTAAACTCGAGTTTAAGCCACCACAAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021565.1-887s21c1
Sequence:CCGGTCCGGAAATACAGATTGATTTCTCGAGAAATCAATCTGTATTTCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021565.1-885s1c1
Sequence:CCGGCTTCCGGAAATACAGATTGATCTCGAGATCAATCTGTATTTCCGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021565.1-1490s21c1
Sequence:CCGGCCATTCTGCAGATACTCAATGCTCGAGCATTGAGTATCTGCAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021565.1-1365s21c1
Sequence:CCGGCAAACCTGGTGCGGTCATTGACTCGAGTCAATGACCGCACCAGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021565.1-1677s1c1
Sequence:CCGGGAGCCAGATTCGAATGTGCAACTCGAGTTGCACATTCGAATCTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021565.1-1490s1c1
Sequence:CCGGCCATTCTGCAGATACTCAATGCTCGAGCATTGAGTATCTGCAGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021565.1-2740s21c1
Sequence:CCGGCCTCCACACACCCACTTATTTCTCGAGAAATAAGTGGGTGTGTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021565
MIDN MISSION shRNA shRNA Plasmid DNA
midnolin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021565.1-1964s21c1
Sequence:CCGGCCGAGTTTGTGGTGGCTTAAACTCGAGTTTAAGCCACCACAAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021565.1-887s21c1
Sequence:CCGGTCCGGAAATACAGATTGATTTCTCGAGAAATCAATCTGTATTTCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021565.1-885s1c1
Sequence:CCGGCTTCCGGAAATACAGATTGATCTCGAGATCAATCTGTATTTCCGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021565.1-1490s21c1
Sequence:CCGGCCATTCTGCAGATACTCAATGCTCGAGCATTGAGTATCTGCAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021565.1-1365s21c1
Sequence:CCGGCAAACCTGGTGCGGTCATTGACTCGAGTCAATGACCGCACCAGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021565.1-1677s1c1
Sequence:CCGGGAGCCAGATTCGAATGTGCAACTCGAGTTGCACATTCGAATCTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021565.1-1490s1c1
Sequence:CCGGCCATTCTGCAGATACTCAATGCTCGAGCATTGAGTATCTGCAGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021565.1-2740s21c1
Sequence:CCGGCCTCCACACACCCACTTATTTCTCGAGAAATAAGTGGGTGTGTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021565
MIDN MISSION shRNA Lentiviral Transduction Particles
midnolin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021565.1-1964s21c1
Sequence:CCGGCCGAGTTTGTGGTGGCTTAAACTCGAGTTTAAGCCACCACAAACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021565.1-887s21c1
Sequence:CCGGTCCGGAAATACAGATTGATTTCTCGAGAAATCAATCTGTATTTCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021565.1-885s1c1
Sequence:CCGGCTTCCGGAAATACAGATTGATCTCGAGATCAATCTGTATTTCCGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021565.1-1490s21c1
Sequence:CCGGCCATTCTGCAGATACTCAATGCTCGAGCATTGAGTATCTGCAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021565.1-1365s21c1
Sequence:CCGGCAAACCTGGTGCGGTCATTGACTCGAGTCAATGACCGCACCAGGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021565.1-1677s1c1
Sequence:CCGGGAGCCAGATTCGAATGTGCAACTCGAGTTGCACATTCGAATCTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021565.1-1490s1c1
Sequence:CCGGCCATTCTGCAGATACTCAATGCTCGAGCATTGAGTATCTGCAGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021565.1-2740s21c1
Sequence:CCGGCCTCCACACACCCACTTATTTCTCGAGAAATAAGTGGGTGTGTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)