EMAIL THIS PAGE TO A FRIEND

MIEN1

migration and invasion enhancer 1

59 Gene Product Result for
Synonyms: C17orf37 C35 ORB3 RDX12 XTP4
UniProtKB ID: Q9BRT3
Gene ID:
Mouse(103742) migration and invasion enhancer 1
Rat(360617) migration and invasion enhancer 1
chicken(100858225) migration and invasion enhancer 1
cow(505710) migration and invasion enhancer 1
domestic cat(101092157) migration and invasion enhancer 1
dog(480532) migration and invasion enhancer 1
domestic guinea pig(100724741) migration and invasion enhancer 1
naked mole-rat(101704861) migration and invasion enhancer 1
sheep(101103995) migration and invasion enhancer 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025559 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025559 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025559 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032339 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032339 Rosetta Predictions human pricing
NM_001108296 Rosetta Predictions rat pricing
NM_025559 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359722 predicted 513
2 SASI_Hs02_00359723 predicted 520
3 SASI_Hs02_00359724 predicted 381
4 SASI_Hs02_00359725 predicted 325
5 SASI_Hs01_00088245 predicted 321
6 SASI_Hs01_00088246 predicted 284
7 SASI_Hs01_00088247 predicted 245
8 SASI_Hs01_00088248 predicted 474
9 SASI_Hs02_00359726 predicted 324
10 SASI_Hs01_00088249 predicted 302
11 SASI_Hs01_00088244 predicted 222
12 SASI_Hs01_00088250 predicted 225
13 SASI_Hs01_00088251 predicted 379
14 SASI_Hs01_00088252 predicted 321
15 SASI_Hs01_00088253 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237259 predicted 448
2 SASI_Rn02_00237260 predicted 325
3 SASI_Rn02_00237261 predicted 226
4 SASI_Rn02_00237262 predicted 502
5 SASI_Rn02_00237263 predicted 476
6 SASI_Rn02_00237264 predicted 522
7 SASI_Rn02_00237265 predicted 499
8 SASI_Rn02_00237266 predicted 478
9 SASI_Rn02_00237267 predicted 374
10 SASI_Rn02_00237268 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061625 predicted 269
2 SASI_Mm01_00061626 predicted 231
3 SASI_Mm01_00061627 predicted 374
4 SASI_Mm01_00061628 predicted 324
5 SASI_Mm01_00061629 predicted 274
6 SASI_Mm02_00328524 predicted 302
7 SASI_Mm01_00061630 predicted 248
8 SASI_Mm01_00061631 predicted 482
9 SASI_Mm01_00061632 predicted 505
10 SASI_Mm01_00061633 predicted 422
11 SASI_Mm01_00061634 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025559
VALIDATED
MIEN1 MISSION shRNA Bacterial Glycerol Stock
migration and invasion enhancer 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025559.1-245s1c1
Sequence:CCGGGTGTTCTCCAAGCTGGAGAATCTCGAGATTCTCCAGCTTGGAGAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184246    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025559.1-431s1c1
Sequence:CCGGGCTAGGAATCCCTCTACCTTTCTCGAGAAAGGTAGAGGGATTCCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025559.1-419s1c1
Sequence:CCGGCCTTGTGGTTACGCTAGGAATCTCGAGATTCCTAGCGTAACCACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025559.1-275s1c1
Sequence:CCGGCCTTATGAGAAAGACCTCATGCTCGAGCATGAGGTCTTTCTCATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025559.1-315s1c1
Sequence:CCGGGCAATGGAGAACCTGTAGAAACTCGAGTTTCTACAGGTTCTCCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025559.2-188s21c1
Sequence:CCGGAGTATCCGGGCATTGAGATTGCTCGAGCAATCTCAATGCCCGGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025559.2-448s21c1
Sequence:CCGGGCTAGGAATCCCTCTACCTTTCTCGAGAAAGGTAGAGGGATTCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329381    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025559.2-436s21c1
Sequence:CCGGCCTTGTGGTTACGCTAGGAATCTCGAGATTCCTAGCGTAACCACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025559.2-379s21c1
Sequence:CCGGGTCATCCTGTGACTAAGAAATCTCGAGATTTCTTAGTCACAGGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025559.2-332s21c1
Sequence:CCGGGCAATGGAGAACCTGTAGAAACTCGAGTTTCTACAGGTTCTCCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025559.2-233s1c1
Sequence:CCGGCCTTCGAGATTGAGATCAATGCTCGAGCATTGATCTCAATCTCGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025559
VALIDATED
MIEN1 MISSION shRNA shRNA Plasmid DNA
migration and invasion enhancer 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025559.1-245s1c1
Sequence:CCGGGTGTTCTCCAAGCTGGAGAATCTCGAGATTCTCCAGCTTGGAGAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184246    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025559.1-431s1c1
Sequence:CCGGGCTAGGAATCCCTCTACCTTTCTCGAGAAAGGTAGAGGGATTCCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025559.1-419s1c1
Sequence:CCGGCCTTGTGGTTACGCTAGGAATCTCGAGATTCCTAGCGTAACCACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025559.1-275s1c1
Sequence:CCGGCCTTATGAGAAAGACCTCATGCTCGAGCATGAGGTCTTTCTCATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025559.1-315s1c1
Sequence:CCGGGCAATGGAGAACCTGTAGAAACTCGAGTTTCTACAGGTTCTCCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025559.2-188s21c1
Sequence:CCGGAGTATCCGGGCATTGAGATTGCTCGAGCAATCTCAATGCCCGGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025559.2-448s21c1
Sequence:CCGGGCTAGGAATCCCTCTACCTTTCTCGAGAAAGGTAGAGGGATTCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329381    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025559.2-436s21c1
Sequence:CCGGCCTTGTGGTTACGCTAGGAATCTCGAGATTCCTAGCGTAACCACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025559.2-379s21c1
Sequence:CCGGGTCATCCTGTGACTAAGAAATCTCGAGATTTCTTAGTCACAGGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025559.2-332s21c1
Sequence:CCGGGCAATGGAGAACCTGTAGAAACTCGAGTTTCTACAGGTTCTCCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025559.2-233s1c1
Sequence:CCGGCCTTCGAGATTGAGATCAATGCTCGAGCATTGATCTCAATCTCGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025559
VALIDATED
MIEN1 MISSION shRNA Lentiviral Transduction Particles
migration and invasion enhancer 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025559.1-245s1c1
Sequence:CCGGGTGTTCTCCAAGCTGGAGAATCTCGAGATTCTCCAGCTTGGAGAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184246    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025559.1-431s1c1
Sequence:CCGGGCTAGGAATCCCTCTACCTTTCTCGAGAAAGGTAGAGGGATTCCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025559.1-419s1c1
Sequence:CCGGCCTTGTGGTTACGCTAGGAATCTCGAGATTCCTAGCGTAACCACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025559.1-275s1c1
Sequence:CCGGCCTTATGAGAAAGACCTCATGCTCGAGCATGAGGTCTTTCTCATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025559.1-315s1c1
Sequence:CCGGGCAATGGAGAACCTGTAGAAACTCGAGTTTCTACAGGTTCTCCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025559.2-188s21c1
Sequence:CCGGAGTATCCGGGCATTGAGATTGCTCGAGCAATCTCAATGCCCGGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025559.2-448s21c1
Sequence:CCGGGCTAGGAATCCCTCTACCTTTCTCGAGAAAGGTAGAGGGATTCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329381    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025559.2-436s21c1
Sequence:CCGGCCTTGTGGTTACGCTAGGAATCTCGAGATTCCTAGCGTAACCACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025559.2-379s21c1
Sequence:CCGGGTCATCCTGTGACTAAGAAATCTCGAGATTTCTTAGTCACAGGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025559.2-332s21c1
Sequence:CCGGGCAATGGAGAACCTGTAGAAACTCGAGTTTCTACAGGTTCTCCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025559.2-233s1c1
Sequence:CCGGCCTTCGAGATTGAGATCAATGCTCGAGCATTGATCTCAATCTCGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032339
VALIDATED
MIEN1 MISSION shRNA Bacterial Glycerol Stock
migration and invasion enhancer 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032339.3-298s1c1
Sequence:CCGGGAAAGATCTCATTGAGGCCATCTCGAGATGGCCTCAATGAGATCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032339.3-478s1c1
Sequence:CCGGCCTACTTAGCTCCTTAGCAAACTCGAGTTTGCTAAGGAGCTAAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032339.3-320s1c1
Sequence:CCGGCGAAGAGCCAGTAATGGAGAACTCGAGTTCTCCATTACTGGCTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032339.3-330s1c1
Sequence:CCGGGTAATGGAGAAACCCTAGAAACTCGAGTTTCTAGGGTTTCTCCATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032339.3-238s1c1
Sequence:CCGGGATAGAGATAAATGGACAGCTCTCGAGAGCTGTCCATTTATCTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032339.3-522s1c1
Sequence:CCGGCTTTGGGTACAAAGAAGGAATCTCGAGATTCCTTCTTTGTACCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032339.3-426s21c1
Sequence:CCGGCCAAACCTTGGTCTCCCTTTGCTCGAGCAAAGGGAGACCAAGGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032339.3-578s21c1
Sequence:CCGGACTCTCCATGAACACTTCTCCCTCGAGGGAGAAGTGTTCATGGAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032339.3-228s21c1
Sequence:CCGGGTGCCTTTGAGATAGAGATAACTCGAGTTATCTCTATCTCAAAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032339.3-184s21c1
Sequence:CCGGGCAGTATCCGGGCATCGAGATCTCGAGATCTCGATGCCCGGATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032339
VALIDATED
MIEN1 MISSION shRNA shRNA Plasmid DNA
migration and invasion enhancer 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032339.3-298s1c1
Sequence:CCGGGAAAGATCTCATTGAGGCCATCTCGAGATGGCCTCAATGAGATCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032339.3-478s1c1
Sequence:CCGGCCTACTTAGCTCCTTAGCAAACTCGAGTTTGCTAAGGAGCTAAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032339.3-320s1c1
Sequence:CCGGCGAAGAGCCAGTAATGGAGAACTCGAGTTCTCCATTACTGGCTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032339.3-330s1c1
Sequence:CCGGGTAATGGAGAAACCCTAGAAACTCGAGTTTCTAGGGTTTCTCCATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032339.3-238s1c1
Sequence:CCGGGATAGAGATAAATGGACAGCTCTCGAGAGCTGTCCATTTATCTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032339.3-522s1c1
Sequence:CCGGCTTTGGGTACAAAGAAGGAATCTCGAGATTCCTTCTTTGTACCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032339.3-426s21c1
Sequence:CCGGCCAAACCTTGGTCTCCCTTTGCTCGAGCAAAGGGAGACCAAGGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032339.3-578s21c1
Sequence:CCGGACTCTCCATGAACACTTCTCCCTCGAGGGAGAAGTGTTCATGGAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032339.3-228s21c1
Sequence:CCGGGTGCCTTTGAGATAGAGATAACTCGAGTTATCTCTATCTCAAAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032339.3-184s21c1
Sequence:CCGGGCAGTATCCGGGCATCGAGATCTCGAGATCTCGATGCCCGGATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032339
VALIDATED
MIEN1 MISSION shRNA Lentiviral Transduction Particles
migration and invasion enhancer 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032339.3-298s1c1
Sequence:CCGGGAAAGATCTCATTGAGGCCATCTCGAGATGGCCTCAATGAGATCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032339.3-478s1c1
Sequence:CCGGCCTACTTAGCTCCTTAGCAAACTCGAGTTTGCTAAGGAGCTAAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032339.3-320s1c1
Sequence:CCGGCGAAGAGCCAGTAATGGAGAACTCGAGTTCTCCATTACTGGCTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032339.3-330s1c1
Sequence:CCGGGTAATGGAGAAACCCTAGAAACTCGAGTTTCTAGGGTTTCTCCATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032339.3-238s1c1
Sequence:CCGGGATAGAGATAAATGGACAGCTCTCGAGAGCTGTCCATTTATCTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032339.3-522s1c1
Sequence:CCGGCTTTGGGTACAAAGAAGGAATCTCGAGATTCCTTCTTTGTACCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032339.3-426s21c1
Sequence:CCGGCCAAACCTTGGTCTCCCTTTGCTCGAGCAAAGGGAGACCAAGGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032339.3-578s21c1
Sequence:CCGGACTCTCCATGAACACTTCTCCCTCGAGGGAGAAGTGTTCATGGAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032339.3-228s21c1
Sequence:CCGGGTGCCTTTGAGATAGAGATAACTCGAGTTATCTCTATCTCAAAGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032339.3-184s21c1
Sequence:CCGGGCAGTATCCGGGCATCGAGATCTCGAGATCTCGATGCCCGGATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)