EMAIL THIS PAGE TO A FRIEND

MIER1

mesoderm induction early response 1, transcriptional regulator

264 Gene Product Result for
Synonyms: ER1 MI-ER1
Gene ID:
Human(57708) Summary: This gene encodes a protein that was first identified in Xenopus laevis by its role in a mesoderm induction early response (MIER). The encoded protein functions as a transcriptional regulator. Alternatively spliced transcript variants encode multiple isoforms, some of which lack a C-terminal nuclear localization signal. [provided by RefSeq, May 2013]
Mouse(71148) mesoderm induction early response 1 homolog (Xenopus laevis
Rat(313418) mesoderm induction early response 1, transcriptional regulator
sheep(101113806) mesoderm induction early response 1 homolog (Xenopus laevis)
naked mole-rat(101698318) mesoderm induction early response 1 homolog (Xenopus laevis)
Domestic Rabbit(100354543) mesoderm induction early response 1 homolog (Xenopus laevis)
domestic guinea pig(100723878) mesoderm induction early response 1 homolog (Xenopus laevis)
chicken(424702) mesoderm induction early response 1 homolog (Xenopus laevis)
domestic cat(101086827) mesoderm induction early response 1 homolog (Xenopus laevis)
cow(538742) mesoderm induction early response 1 homolog (Xenopus laevis)
Horse(100053862) mesoderm induction early response 1 homolog (Xenopus laevis)
dog(479536) mesoderm induction early response 1 homolog (Xenopus laevis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020948 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027696 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027696 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027696 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077700 Rosetta Predictions human pricing
NM_001077701 Rosetta Predictions human pricing
NM_001077702 Rosetta Predictions human pricing
NM_001077703 Rosetta Predictions human pricing
NM_001077704 Rosetta Predictions human pricing
NM_020948 Rosetta Predictions human pricing
NM_001131012 Rosetta Predictions rat pricing
NM_001039081 Rosetta Predictions mouse pricing
NM_027696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313166 predicted 871
2 SASI_Hs02_00313167 predicted 1230
3 SASI_Hs02_00313168 predicted 995
4 SASI_Hs02_00313169 predicted 1190
5 SASI_Hs02_00313170 predicted 1029
6 SASI_Hs02_00313171 predicted 1187
7 SASI_Hs02_00313172 predicted 1145
8 SASI_Hs02_00313173 predicted 813
9 SASI_Hs02_00313174 predicted 788
10 SASI_Hs02_00313175 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313176 predicted 789
2 SASI_Hs02_00313177 predicted 1152
3 SASI_Hs02_00313178 predicted 913
4 SASI_Hs02_00313179 predicted 1109
5 SASI_Hs02_00313180 predicted 953
6 SASI_Hs02_00313181 predicted 1111
7 SASI_Hs02_00313182 predicted 1063
8 SASI_Hs02_00313183 predicted 731
9 SASI_Hs02_00313184 predicted 702
10 SASI_Hs02_00313185 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313186 predicted 949
2 SASI_Hs02_00313187 predicted 1305
3 SASI_Hs02_00313188 predicted 1067
4 SASI_Hs02_00313189 predicted 1262
5 SASI_Hs02_00313190 predicted 1111
6 SASI_Hs02_00313191 predicted 1263
7 SASI_Hs02_00313192 predicted 1219
8 SASI_Hs02_00313193 predicted 888
9 SASI_Hs02_00313194 predicted 861
10 SASI_Hs02_00313195 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313196 predicted 876
2 SASI_Hs02_00313197 predicted 1233
3 SASI_Hs02_00313198 predicted 989
4 SASI_Hs02_00313199 predicted 1184
5 SASI_Hs02_00313200 predicted 1036
6 SASI_Hs02_00313201 predicted 1186
7 SASI_Hs02_00313202 predicted 1143
8 SASI_Hs02_00313203 predicted 811
9 SASI_Hs02_00313204 predicted 783
10 SASI_Hs02_00313205 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313206 predicted 788
2 SASI_Hs02_00313207 predicted 1155
3 SASI_Hs02_00313208 predicted 908
4 SASI_Hs02_00313209 predicted 1101
5 SASI_Hs02_00313210 predicted 954
6 SASI_Hs02_00313211 predicted 1104
7 SASI_Hs02_00313212 predicted 1061
8 SASI_Hs02_00313213 predicted 724
9 SASI_Hs02_00313214 predicted 702
10 SASI_Hs02_00313215 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354357 predicted 950
2 SASI_Hs02_00354358 predicted 1308
3 SASI_Hs01_00031101 predicted 1067
4 SASI_Hs01_00031104 predicted 1265
5 SASI_Hs01_00031105 predicted 1106
6 SASI_Hs02_00354359 predicted 1266
7 SASI_Hs01_00031106 predicted 1221
8 SASI_Hs02_00354360 predicted 884
9 SASI_Hs02_00354361 predicted 864
10 SASI_Hs02_00354362 predicted 958
11 SASI_Hs01_00031099 predicted 1380
12 SASI_Hs01_00031100 predicted 1487
13 SASI_Hs01_00031102 predicted 1631
14 SASI_Hs01_00031103 predicted 1602
15 SASI_Hs01_00031107 predicted 1650
16 SASI_Hs01_00031108 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001131012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256169 predicted 1170
2 SASI_Rn02_00256170 predicted 852
3 SASI_Rn02_00256171 predicted 1539
4 SASI_Rn02_00256172 predicted 866
5 SASI_Rn02_00256173 predicted 1741
6 SASI_Rn02_00256174 predicted 1062
7 SASI_Rn02_00256175 predicted 1424
8 SASI_Rn02_00256176 predicted 1636
9 SASI_Rn02_00256177 predicted 1405
10 SASI_Rn02_00256178 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044664 predicted 1172
2 SASI_Mm01_00044665 predicted 1635
3 SASI_Mm01_00044666 predicted 1064
4 SASI_Mm01_00044667 predicted 1612
5 SASI_Mm01_00044668 predicted 859
6 SASI_Mm01_00044672 predicted 888
7 SASI_Mm01_00044673 predicted 1729
8 SASI_Mm02_00289768 predicted 1303
9 SASI_Mm02_00289769 predicted 1028
10 SASI_Mm02_00289770 predicted 1258
11 SASI_Mm01_00044669 predicted 1566
12 SASI_Mm01_00044670 predicted 1455
13 SASI_Mm01_00044671 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121681 predicted 1287
2 SASI_Mm01_00121682 predicted 1752
3 SASI_Mm01_00121683 predicted 1180
4 SASI_Mm01_00121684 predicted 1723
5 SASI_Mm01_00121685 predicted 972
6 SASI_Mm01_00121689 predicted 997
7 SASI_Mm01_00121690 predicted 1848
8 SASI_Mm02_00332582 predicted 1419
9 SASI_Mm02_00332583 predicted 1135
10 SASI_Mm02_00332584 predicted 1373
11 SASI_Mm01_00121686 predicted 1677
12 SASI_Mm01_00121687 predicted 1567
13 SASI_Mm01_00121688 predicted 1026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020948
VALIDATED
MIER1 MISSION shRNA Bacterial Glycerol Stock
mesoderm induction early response 1, transcriptional regulator
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020948.1-3503s1c1
Sequence:CCGGCCCATGAAGTATTACTGTTAACTCGAGTTAACAGTAATACTTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020948.1-517s1c1
Sequence:CCGGGCCTTTATGGTTATGGTAGTACTCGAGTACTACCATAACCATAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020948.1-697s1c1
Sequence:CCGGCCAATGATGATCCATCACAATCTCGAGATTGTGATGGATCATCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020948.1-874s1c1
Sequence:CCGGCAGAAATTCCAGTTGGCATTTCTCGAGAAATGCCAACTGGAATTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020948.1-298s1c1
Sequence:CCGGCCTGTCAAATTACCCAGCCATCTCGAGATGGCTGGGTAATTTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_020948.3-809s21c1
Sequence:CCGGATCCGCCCACGTCGATGTAAACTCGAGTTTACATCGACGTGGGCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_020948.3-464s21c1
Sequence:CCGGTTTGATGATGAACGAACATTACTCGAGTAATGTTCGTTCATCATCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020948.3-2298s21c1
Sequence:CCGGTGGGAAACTCAAGTCCAAATTCTCGAGAATTTGGACTTGAGTTTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020948.3-936s21c1
Sequence:CCGGCAGAAATTCCAGTTGGCATTTCTCGAGAAATGCCAACTGGAATTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020948.3-1679s21c1
Sequence:CCGGCATGCAGATATGGATACTAATCTCGAGATTAGTATCCATATCTGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020948
VALIDATED
MIER1 MISSION shRNA shRNA Plasmid DNA
mesoderm induction early response 1, transcriptional regulator
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020948.1-3503s1c1
Sequence:CCGGCCCATGAAGTATTACTGTTAACTCGAGTTAACAGTAATACTTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020948.1-517s1c1
Sequence:CCGGGCCTTTATGGTTATGGTAGTACTCGAGTACTACCATAACCATAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020948.1-697s1c1
Sequence:CCGGCCAATGATGATCCATCACAATCTCGAGATTGTGATGGATCATCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020948.1-874s1c1
Sequence:CCGGCAGAAATTCCAGTTGGCATTTCTCGAGAAATGCCAACTGGAATTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020948.1-298s1c1
Sequence:CCGGCCTGTCAAATTACCCAGCCATCTCGAGATGGCTGGGTAATTTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_020948.3-809s21c1
Sequence:CCGGATCCGCCCACGTCGATGTAAACTCGAGTTTACATCGACGTGGGCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_020948.3-464s21c1
Sequence:CCGGTTTGATGATGAACGAACATTACTCGAGTAATGTTCGTTCATCATCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020948.3-2298s21c1
Sequence:CCGGTGGGAAACTCAAGTCCAAATTCTCGAGAATTTGGACTTGAGTTTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020948.3-936s21c1
Sequence:CCGGCAGAAATTCCAGTTGGCATTTCTCGAGAAATGCCAACTGGAATTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020948.3-1679s21c1
Sequence:CCGGCATGCAGATATGGATACTAATCTCGAGATTAGTATCCATATCTGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020948
VALIDATED
MIER1 MISSION shRNA Lentiviral Transduction Particles
mesoderm induction early response 1, transcriptional regulator
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020948.1-3503s1c1
Sequence:CCGGCCCATGAAGTATTACTGTTAACTCGAGTTAACAGTAATACTTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020948.1-517s1c1
Sequence:CCGGGCCTTTATGGTTATGGTAGTACTCGAGTACTACCATAACCATAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020948.1-697s1c1
Sequence:CCGGCCAATGATGATCCATCACAATCTCGAGATTGTGATGGATCATCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020948.1-874s1c1
Sequence:CCGGCAGAAATTCCAGTTGGCATTTCTCGAGAAATGCCAACTGGAATTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020948.1-298s1c1
Sequence:CCGGCCTGTCAAATTACCCAGCCATCTCGAGATGGCTGGGTAATTTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_020948.3-809s21c1
Sequence:CCGGATCCGCCCACGTCGATGTAAACTCGAGTTTACATCGACGTGGGCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_020948.3-464s21c1
Sequence:CCGGTTTGATGATGAACGAACATTACTCGAGTAATGTTCGTTCATCATCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020948.3-2298s21c1
Sequence:CCGGTGGGAAACTCAAGTCCAAATTCTCGAGAATTTGGACTTGAGTTTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020948.3-936s21c1
Sequence:CCGGCAGAAATTCCAGTTGGCATTTCTCGAGAAATGCCAACTGGAATTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020948.3-1679s21c1
Sequence:CCGGCATGCAGATATGGATACTAATCTCGAGATTAGTATCCATATCTGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027696
MIER1 MISSION shRNA Bacterial Glycerol Stock
mesoderm induction early response 1, transcriptional regulator
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027696.1-1134s1c1
Sequence:CCGGGCATTCTATTACATGTGGAAACTCGAGTTTCCACATGTAATAGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027696.1-969s1c1
Sequence:CCGGGCCTTGAGAAGACTGAGATTTCTCGAGAAATCTCAGTCTTCTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027696.1-318s1c1
Sequence:CCGGAGTTCTGAAATAGAGGATCTTCTCGAGAAGATCCTCTATTTCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027696.1-608s1c1
Sequence:CCGGCCCACGTCGATGTAAATATTTCTCGAGAAATATTTACATCGACGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027696.1-1388s1c1
Sequence:CCGGACCAGGAGAAATACTAAACAACTCGAGTTGTTTAGTATTTCTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027696
MIER1 MISSION shRNA shRNA Plasmid DNA
mesoderm induction early response 1, transcriptional regulator
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027696.1-1134s1c1
Sequence:CCGGGCATTCTATTACATGTGGAAACTCGAGTTTCCACATGTAATAGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027696.1-969s1c1
Sequence:CCGGGCCTTGAGAAGACTGAGATTTCTCGAGAAATCTCAGTCTTCTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027696.1-318s1c1
Sequence:CCGGAGTTCTGAAATAGAGGATCTTCTCGAGAAGATCCTCTATTTCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027696.1-608s1c1
Sequence:CCGGCCCACGTCGATGTAAATATTTCTCGAGAAATATTTACATCGACGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027696.1-1388s1c1
Sequence:CCGGACCAGGAGAAATACTAAACAACTCGAGTTGTTTAGTATTTCTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027696
MIER1 MISSION shRNA Lentiviral Transduction Particles
mesoderm induction early response 1, transcriptional regulator
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027696.1-1134s1c1
Sequence:CCGGGCATTCTATTACATGTGGAAACTCGAGTTTCCACATGTAATAGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027696.1-969s1c1
Sequence:CCGGGCCTTGAGAAGACTGAGATTTCTCGAGAAATCTCAGTCTTCTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027696.1-318s1c1
Sequence:CCGGAGTTCTGAAATAGAGGATCTTCTCGAGAAGATCCTCTATTTCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027696.1-608s1c1
Sequence:CCGGCCCACGTCGATGTAAATATTTCTCGAGAAATATTTACATCGACGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027696.1-1388s1c1
Sequence:CCGGACCAGGAGAAATACTAAACAACTCGAGTTGTTTAGTATTTCTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)