EMAIL THIS PAGE TO A FRIEND

MIER2

mesoderm induction early response 1, family member 2

49 Gene Product Result for
Synonyms: KIAA1193 Mi-er2
UniProtKB ID: Q8N344, Q9ULM7
Gene ID:
Mouse(70427) mesoderm induction early response 1, family member 2
Rat(362841) mesoderm induction early response 1, family member 2
Zebrafish(326096) mesoderm induction early response 1, family member 2
cow(523726) mesoderm induction early response 1, family member 2
domestic cat(101089244) mesoderm induction early response 1, family member 2
dog(612437) mesoderm induction early response 1, family member 2
chicken(770192) mesoderm induction early response 1, family member 2
domestic guinea pig(100734857) mesoderm induction early response 1, family member 2
naked mole-rat(101725247) mesoderm induction early response 1, family member 2
sheep(101107194) mesoderm induction early response 1, family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017550 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012301 MISSION® esiRNA esiRNA targeting human MIER2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017550 Rosetta Predictions human pricing
NM_001108737 Rosetta Predictions rat pricing
NM_027422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064173 predicted 1530
2 SASI_Hs01_00064174 predicted 475
3 SASI_Hs01_00064175 predicted 500
4 SASI_Hs01_00064176 predicted 1750
5 SASI_Hs01_00064177 predicted 805
6 SASI_Hs01_00064178 predicted 1509
7 SASI_Hs01_00064179 predicted 654
8 SASI_Hs01_00064180 predicted 563
9 SASI_Hs01_00064181 predicted 377
10 SASI_Hs01_00064182 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241585 predicted 881
2 SASI_Rn02_00241586 predicted 1492
3 SASI_Rn02_00241587 predicted 1247
4 SASI_Rn02_00241588 predicted 959
5 SASI_Rn02_00241589 predicted 968
6 SASI_Rn02_00241590 predicted 649
7 SASI_Rn02_00241591 predicted 1415
8 SASI_Rn02_00241592 predicted 1493
9 SASI_Rn02_00241593 predicted 634
10 SASI_Rn02_00241594 predicted 1676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090679 predicted 356
2 SASI_Mm02_00332165 predicted 934
3 SASI_Mm01_00090680 predicted 1499
4 SASI_Mm01_00090681 predicted 637
5 SASI_Mm01_00090682 predicted 1201
6 SASI_Mm01_00090684 predicted 806
7 SASI_Mm01_00090686 predicted 1047
8 SASI_Mm01_00090687 predicted 1652
9 SASI_Mm01_00090688 predicted 727
10 SASI_Mm02_00332166 predicted 228
11 SASI_Mm01_00090683 predicted 1538
12 SASI_Mm01_00090685 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017550
VALIDATED
MIER2 MISSION shRNA Bacterial Glycerol Stock
mesoderm induction early response 1, family member 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017550.1-1531s1c1
Sequence:CCGGGAGTTTGGACTCATCGGCATTCTCGAGAATGCCGATGAGTCCAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017550.1-957s1c1
Sequence:CCGGGCATGGAAAGAACTTTCACCTCTCGAGAGGTGAAAGTTCTTTCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_017550.1-825s1c1
Sequence:CCGGCGAGTTGGTGAAATGCAACTTCTCGAGAAGTTGCATTTCACCAACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_017550.1-412s1c1
Sequence:CCGGGAAGAGGAAGAGACGCAATCACTCGAGTGATTGCGTCTCTTCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017550.1-409s1c1
Sequence:CCGGGAAGAAGAGGAAGAGACGCAACTCGAGTTGCGTCTCTTCCTCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-378s21c1
Sequence:CCGGAGAACAAATAGCGAAGGATTTCTCGAGAAATCCTTCGCTATTTGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-489s21c1
Sequence:CCGGTAACCGGAGTGGATCTCGTTTCTCGAGAAACGAGATCCACTCCGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-1617s21c1
Sequence:CCGGCCTGTCACACTGTAACGTGATCTCGAGATCACGTTACAGTGTGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-253s21c1
Sequence:CCGGAGCAACGACATGCCCTTTGATCTCGAGATCAAAGGGCATGTCGTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-881s21c1
Sequence:CCGCACGTGAAGGTGATCCGAGATGCTCGAGCATCTCGGATCACCTTCACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-791s21c1
Sequence:CCGGGAGAAGCCGTGAAAGACAGTGCTCGAGCACTGTCTTTCACGGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017550.1-1753s21c1
Sequence:CCGGGTAGCACCTCCTTCTGCTTCACTCGAGTGAAGCAGAAGGAGGTGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-313s21c1
Sequence:CCGGATTTCAGACCGGGAGAGTGAGCTCGAGCTCACTCTCCCGGTCTGAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-135s21c1
Sequence:CCGGTCAGTTCAACCTCGCAGAGATCTCGAGATCTCTGCGAGGTTGAACTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-1013s21c1
Sequence:CCGGGCGAGTGTGTCGAGTACTACTCTCGAGAGTAGTACTCGACACACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-597s21c1
Sequence:CCGGGATCATGGTGGGACCTCAGTTCTCGAGAACTGAGGTCCCACCATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017550
VALIDATED
MIER2 MISSION shRNA shRNA Plasmid DNA
mesoderm induction early response 1, family member 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017550.1-1531s1c1
Sequence:CCGGGAGTTTGGACTCATCGGCATTCTCGAGAATGCCGATGAGTCCAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017550.1-957s1c1
Sequence:CCGGGCATGGAAAGAACTTTCACCTCTCGAGAGGTGAAAGTTCTTTCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_017550.1-825s1c1
Sequence:CCGGCGAGTTGGTGAAATGCAACTTCTCGAGAAGTTGCATTTCACCAACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_017550.1-412s1c1
Sequence:CCGGGAAGAGGAAGAGACGCAATCACTCGAGTGATTGCGTCTCTTCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017550.1-409s1c1
Sequence:CCGGGAAGAAGAGGAAGAGACGCAACTCGAGTTGCGTCTCTTCCTCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-378s21c1
Sequence:CCGGAGAACAAATAGCGAAGGATTTCTCGAGAAATCCTTCGCTATTTGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-489s21c1
Sequence:CCGGTAACCGGAGTGGATCTCGTTTCTCGAGAAACGAGATCCACTCCGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-1617s21c1
Sequence:CCGGCCTGTCACACTGTAACGTGATCTCGAGATCACGTTACAGTGTGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-253s21c1
Sequence:CCGGAGCAACGACATGCCCTTTGATCTCGAGATCAAAGGGCATGTCGTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-881s21c1
Sequence:CCGCACGTGAAGGTGATCCGAGATGCTCGAGCATCTCGGATCACCTTCACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-791s21c1
Sequence:CCGGGAGAAGCCGTGAAAGACAGTGCTCGAGCACTGTCTTTCACGGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017550.1-1753s21c1
Sequence:CCGGGTAGCACCTCCTTCTGCTTCACTCGAGTGAAGCAGAAGGAGGTGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-313s21c1
Sequence:CCGGATTTCAGACCGGGAGAGTGAGCTCGAGCTCACTCTCCCGGTCTGAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-135s21c1
Sequence:CCGGTCAGTTCAACCTCGCAGAGATCTCGAGATCTCTGCGAGGTTGAACTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-1013s21c1
Sequence:CCGGGCGAGTGTGTCGAGTACTACTCTCGAGAGTAGTACTCGACACACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-597s21c1
Sequence:CCGGGATCATGGTGGGACCTCAGTTCTCGAGAACTGAGGTCCCACCATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017550
VALIDATED
MIER2 MISSION shRNA Lentiviral Transduction Particles
mesoderm induction early response 1, family member 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017550.1-1531s1c1
Sequence:CCGGGAGTTTGGACTCATCGGCATTCTCGAGAATGCCGATGAGTCCAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017550.1-957s1c1
Sequence:CCGGGCATGGAAAGAACTTTCACCTCTCGAGAGGTGAAAGTTCTTTCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_017550.1-825s1c1
Sequence:CCGGCGAGTTGGTGAAATGCAACTTCTCGAGAAGTTGCATTTCACCAACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_017550.1-412s1c1
Sequence:CCGGGAAGAGGAAGAGACGCAATCACTCGAGTGATTGCGTCTCTTCCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017550.1-409s1c1
Sequence:CCGGGAAGAAGAGGAAGAGACGCAACTCGAGTTGCGTCTCTTCCTCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-378s21c1
Sequence:CCGGAGAACAAATAGCGAAGGATTTCTCGAGAAATCCTTCGCTATTTGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-489s21c1
Sequence:CCGGTAACCGGAGTGGATCTCGTTTCTCGAGAAACGAGATCCACTCCGGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-1617s21c1
Sequence:CCGGCCTGTCACACTGTAACGTGATCTCGAGATCACGTTACAGTGTGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-253s21c1
Sequence:CCGGAGCAACGACATGCCCTTTGATCTCGAGATCAAAGGGCATGTCGTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-881s21c1
Sequence:CCGCACGTGAAGGTGATCCGAGATGCTCGAGCATCTCGGATCACCTTCACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-791s21c1
Sequence:CCGGGAGAAGCCGTGAAAGACAGTGCTCGAGCACTGTCTTTCACGGCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017550.1-1753s21c1
Sequence:CCGGGTAGCACCTCCTTCTGCTTCACTCGAGTGAAGCAGAAGGAGGTGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-313s21c1
Sequence:CCGGATTTCAGACCGGGAGAGTGAGCTCGAGCTCACTCTCCCGGTCTGAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-135s21c1
Sequence:CCGGTCAGTTCAACCTCGCAGAGATCTCGAGATCTCTGCGAGGTTGAACTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-1013s21c1
Sequence:CCGGGCGAGTGTGTCGAGTACTACTCTCGAGAGTAGTACTCGACACACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017550.1-597s21c1
Sequence:CCGGGATCATGGTGGGACCTCAGTTCTCGAGAACTGAGGTCCCACCATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027422
VALIDATED
MIER2 MISSION shRNA Bacterial Glycerol Stock
mesoderm induction early response 1, family member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027422.2-1108s1c1
Sequence:CCGGACGGATACTGAACAGGACCTACTCGAGTAGGTCCTGTTCAGTATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027422.2-640s1c1
Sequence:CCGGCGACATTGTGACAAGATCTATCTCGAGATAGATCTTGTCACAATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027422.2-1507s1c1
Sequence:CCGGGTCACTGAATTTGGACTCATTCTCGAGAATGAGTCCAAATTCAGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027422.2-942s1c1
Sequence:CCGGCCGTGTTCATGGGAAGAACTTCTCGAGAAGTTCTTCCCATGAACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027422.2-1743s1c1
Sequence:CCGGGCTTCAGAACATGGTGGGATTCTCGAGAATCCCACCATGTTCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027422.2-816s21c1
Sequence:CCGGTGAGCTCGTGAAGTGTAATTTCTCGAGAAATTACACTTCACGAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027422.2-1003s21c1
Sequence:CCGGGGCGAGTGTGTGGAGTATTATCTCGAGATAATACTCCACACACTCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027422.2-1507s21c1
Sequence:CCGGGTCACTGAATTTGGACTCATTCTCGAGAATGAGTCCAAATTCAGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027422.2-1743s21c1
Sequence:CCGGGCTTCAGAACATGGTGGGATTCTCGAGAATCCCACCATGTTCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027422.2-640s21c1
Sequence:CCGGCGACATTGTGACAAGATCTATCTCGAGATAGATCTTGTCACAATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027422
VALIDATED
MIER2 MISSION shRNA shRNA Plasmid DNA
mesoderm induction early response 1, family member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027422.2-1108s1c1
Sequence:CCGGACGGATACTGAACAGGACCTACTCGAGTAGGTCCTGTTCAGTATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027422.2-640s1c1
Sequence:CCGGCGACATTGTGACAAGATCTATCTCGAGATAGATCTTGTCACAATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027422.2-1507s1c1
Sequence:CCGGGTCACTGAATTTGGACTCATTCTCGAGAATGAGTCCAAATTCAGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027422.2-942s1c1
Sequence:CCGGCCGTGTTCATGGGAAGAACTTCTCGAGAAGTTCTTCCCATGAACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027422.2-1743s1c1
Sequence:CCGGGCTTCAGAACATGGTGGGATTCTCGAGAATCCCACCATGTTCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027422.2-816s21c1
Sequence:CCGGTGAGCTCGTGAAGTGTAATTTCTCGAGAAATTACACTTCACGAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027422.2-1003s21c1
Sequence:CCGGGGCGAGTGTGTGGAGTATTATCTCGAGATAATACTCCACACACTCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027422.2-1507s21c1
Sequence:CCGGGTCACTGAATTTGGACTCATTCTCGAGAATGAGTCCAAATTCAGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027422.2-1743s21c1
Sequence:CCGGGCTTCAGAACATGGTGGGATTCTCGAGAATCCCACCATGTTCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027422.2-640s21c1
Sequence:CCGGCGACATTGTGACAAGATCTATCTCGAGATAGATCTTGTCACAATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027422
VALIDATED
MIER2 MISSION shRNA Lentiviral Transduction Particles
mesoderm induction early response 1, family member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027422.2-1108s1c1
Sequence:CCGGACGGATACTGAACAGGACCTACTCGAGTAGGTCCTGTTCAGTATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027422.2-640s1c1
Sequence:CCGGCGACATTGTGACAAGATCTATCTCGAGATAGATCTTGTCACAATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027422.2-1507s1c1
Sequence:CCGGGTCACTGAATTTGGACTCATTCTCGAGAATGAGTCCAAATTCAGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027422.2-942s1c1
Sequence:CCGGCCGTGTTCATGGGAAGAACTTCTCGAGAAGTTCTTCCCATGAACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027422.2-1743s1c1
Sequence:CCGGGCTTCAGAACATGGTGGGATTCTCGAGAATCCCACCATGTTCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027422.2-816s21c1
Sequence:CCGGTGAGCTCGTGAAGTGTAATTTCTCGAGAAATTACACTTCACGAGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027422.2-1003s21c1
Sequence:CCGGGGCGAGTGTGTGGAGTATTATCTCGAGATAATACTCCACACACTCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027422.2-1507s21c1
Sequence:CCGGGTCACTGAATTTGGACTCATTCTCGAGAATGAGTCCAAATTCAGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027422.2-1743s21c1
Sequence:CCGGGCTTCAGAACATGGTGGGATTCTCGAGAATCCCACCATGTTCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027422.2-640s21c1
Sequence:CCGGCGACATTGTGACAAGATCTATCTCGAGATAGATCTTGTCACAATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)