EMAIL THIS PAGE TO A FRIEND

MIF4GD

MIF4G domain containing

60 Gene Product Result for
Synonyms: AD023 MIFD SLIP1
UniProtKB ID: A9UHW6, B4DUM7, Q8N4Q5, Q9HBL5
Gene ID:
Human(57409) Summary: This gene encodes a protein which interacts with the N-terminus of the stem-loop binding protein (SLBP) and the 3' end of histone mRNA. This interaction facilitates the activation of histone mRNA translation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
Mouse(69674) MIF4G domain containing
Rat(360659) MIF4G domain containing
chicken(100858848) MIF4G domain containing
dog(608610) MIF4G domain containing
domestic cat(101099671) MIF4G domain containing
cow(613305) MIF4G domain containing
sheep(101121439) MIF4G domain containing
naked mole-rat(101715996) MIF4G domain containing
domestic guinea pig(100714982) MIF4G domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40950 Anti-MIF4GD antibody produced in rabbit IgG fraction of antiserum human, guinea pig, rabbit, horse, canine, bovine, rat, mouse, zebrafish
immunohistochemistry, western blot pricing
HPA051222 Anti-MIF4GD antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103978 Anti-MIF4GD, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, horse, human, rat, zebrafish, rabbit, canine, guinea pig, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020679 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020679 Rosetta Predictions human pricing
NM_001014122 Rosetta Predictions rat pricing
NM_027162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166647 predicted 526
2 SASI_Hs01_00166648 predicted 287
3 SASI_Hs01_00166649 predicted 337
4 SASI_Hs02_00353670 predicted 589
5 SASI_Hs01_00166650 predicted 445
6 SASI_Hs01_00166651 predicted 861
7 SASI_Hs01_00166652 predicted 410
8 SASI_Hs01_00166653 predicted 408
9 SASI_Hs01_00166654 predicted 343
10 SASI_Hs01_00166655 predicted 573
11 SASI_Hs01_00166656 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100702 predicted 1042
2 SASI_Rn01_00100704 predicted 633
3 SASI_Rn01_00100705 predicted 229
4 SASI_Rn01_00100706 predicted 237
5 SASI_Rn01_00100707 predicted 787
6 SASI_Rn01_00100708 predicted 765
7 SASI_Rn01_00100710 predicted 635
8 SASI_Rn02_00201567 predicted 507
9 SASI_Rn02_00201568 predicted 636
10 SASI_Rn01_00100711 predicted 478
11 SASI_Rn01_00100703 predicted 434
12 SASI_Rn01_00100709 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032803 predicted 1403
2 SASI_Mm01_00032804 predicted 1023
3 SASI_Mm01_00032805 predicted 1024
4 SASI_Mm01_00032806 predicted 1417
5 SASI_Mm01_00032807 predicted 623
6 SASI_Mm01_00032808 predicted 615
7 SASI_Mm01_00032810 predicted 617
8 SASI_Mm01_00032811 predicted 892
9 SASI_Mm01_00032812 predicted 862
10 SASI_Mm02_00331672 predicted 1394
11 SASI_Mm01_00032809 predicted 704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020679
VALIDATED
MIF4GD MISSION shRNA Bacterial Glycerol Stock
MIF4G domain containing
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020679.2-1137s21c1
Sequence:CCGGCCACTGCACTGTGTAACCATTCTCGAGAATGGTTACACAGTGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020679.2-223s21c1
Sequence:CCGGGAGACAGAAGATGGAGAATATCTCGAGATATTCTCCATCTTCTGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020679.2-413s21c1
Sequence:CCGGCCATCATTCAGGCAGAGAGTACTCGAGTACTCTCTGCCTGAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020679.2-557s21c1
Sequence:CCGGGCAACATCTTTGACTACCTGACTCGAGTCAGGTAGTCAAAGATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020679.2-996s1c1
Sequence:CCGGCTTCCAGACTTTGAGTGTCTTCTCGAGAAGACACTCAAAGTCTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020679.2-557s1c1
Sequence:CCGGGCAACATCTTTGACTACCTGACTCGAGTCAGGTAGTCAAAGATGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020679.2-344s1c1
Sequence:CCGGCCAATGTGATTGTGGACCATTCTCGAGAATGGTCCACAATCACATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020679.2-867s1c1
Sequence:CCGGCCACAAGTATTACTACAGCGACTCGAGTCGCTGTAGTAATACTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020679.2-1137s1c1
Sequence:CCGGCCACTGCACTGTGTAACCATTCTCGAGAATGGTTACACAGTGCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020679.2-413s1c1
Sequence:CCGGCCATCATTCAGGCAGAGAGTACTCGAGTACTCTCTGCCTGAATGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140008    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020679.2-1178s1c1
Sequence:CCGGGCCTCAGTTTACCCATCTGTACTCGAGTACAGATGGGTAAACTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020679.2-202s1c1
Sequence:CCGGGCACTCAAAGTTGCCTGCTTTCTCGAGAAAGCAGGCAACTTTGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020679.2-214s1c1
Sequence:CCGGGCCTGCTTTGAGACAGAAGATCTCGAGATCTTCTGTCTCAAAGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020679.2-813s1c1
Sequence:CCGGGCTGCTGGAGATCATTGAGTTCTCGAGAACTCAATGATCTCCAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020679.2-223s1c1
Sequence:CCGGGAGACAGAAGATGGAGAATATCTCGAGATATTCTCCATCTTCTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020679
VALIDATED
MIF4GD MISSION shRNA shRNA Plasmid DNA
MIF4G domain containing
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020679.2-1137s21c1
Sequence:CCGGCCACTGCACTGTGTAACCATTCTCGAGAATGGTTACACAGTGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020679.2-223s21c1
Sequence:CCGGGAGACAGAAGATGGAGAATATCTCGAGATATTCTCCATCTTCTGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020679.2-413s21c1
Sequence:CCGGCCATCATTCAGGCAGAGAGTACTCGAGTACTCTCTGCCTGAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020679.2-557s21c1
Sequence:CCGGGCAACATCTTTGACTACCTGACTCGAGTCAGGTAGTCAAAGATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020679.2-996s1c1
Sequence:CCGGCTTCCAGACTTTGAGTGTCTTCTCGAGAAGACACTCAAAGTCTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020679.2-557s1c1
Sequence:CCGGGCAACATCTTTGACTACCTGACTCGAGTCAGGTAGTCAAAGATGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020679.2-344s1c1
Sequence:CCGGCCAATGTGATTGTGGACCATTCTCGAGAATGGTCCACAATCACATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020679.2-867s1c1
Sequence:CCGGCCACAAGTATTACTACAGCGACTCGAGTCGCTGTAGTAATACTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020679.2-1137s1c1
Sequence:CCGGCCACTGCACTGTGTAACCATTCTCGAGAATGGTTACACAGTGCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020679.2-413s1c1
Sequence:CCGGCCATCATTCAGGCAGAGAGTACTCGAGTACTCTCTGCCTGAATGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140008    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020679.2-1178s1c1
Sequence:CCGGGCCTCAGTTTACCCATCTGTACTCGAGTACAGATGGGTAAACTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020679.2-202s1c1
Sequence:CCGGGCACTCAAAGTTGCCTGCTTTCTCGAGAAAGCAGGCAACTTTGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020679.2-214s1c1
Sequence:CCGGGCCTGCTTTGAGACAGAAGATCTCGAGATCTTCTGTCTCAAAGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020679.2-813s1c1
Sequence:CCGGGCTGCTGGAGATCATTGAGTTCTCGAGAACTCAATGATCTCCAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020679.2-223s1c1
Sequence:CCGGGAGACAGAAGATGGAGAATATCTCGAGATATTCTCCATCTTCTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020679
VALIDATED
MIF4GD MISSION shRNA Lentiviral Transduction Particles
MIF4G domain containing
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020679.2-1137s21c1
Sequence:CCGGCCACTGCACTGTGTAACCATTCTCGAGAATGGTTACACAGTGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020679.2-223s21c1
Sequence:CCGGGAGACAGAAGATGGAGAATATCTCGAGATATTCTCCATCTTCTGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020679.2-413s21c1
Sequence:CCGGCCATCATTCAGGCAGAGAGTACTCGAGTACTCTCTGCCTGAATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020679.2-557s21c1
Sequence:CCGGGCAACATCTTTGACTACCTGACTCGAGTCAGGTAGTCAAAGATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020679.2-996s1c1
Sequence:CCGGCTTCCAGACTTTGAGTGTCTTCTCGAGAAGACACTCAAAGTCTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020679.2-557s1c1
Sequence:CCGGGCAACATCTTTGACTACCTGACTCGAGTCAGGTAGTCAAAGATGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020679.2-344s1c1
Sequence:CCGGCCAATGTGATTGTGGACCATTCTCGAGAATGGTCCACAATCACATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020679.2-867s1c1
Sequence:CCGGCCACAAGTATTACTACAGCGACTCGAGTCGCTGTAGTAATACTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020679.2-1137s1c1
Sequence:CCGGCCACTGCACTGTGTAACCATTCTCGAGAATGGTTACACAGTGCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020679.2-413s1c1
Sequence:CCGGCCATCATTCAGGCAGAGAGTACTCGAGTACTCTCTGCCTGAATGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140008    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020679.2-1178s1c1
Sequence:CCGGGCCTCAGTTTACCCATCTGTACTCGAGTACAGATGGGTAAACTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020679.2-202s1c1
Sequence:CCGGGCACTCAAAGTTGCCTGCTTTCTCGAGAAAGCAGGCAACTTTGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020679.2-214s1c1
Sequence:CCGGGCCTGCTTTGAGACAGAAGATCTCGAGATCTTCTGTCTCAAAGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020679.2-813s1c1
Sequence:CCGGGCTGCTGGAGATCATTGAGTTCTCGAGAACTCAATGATCTCCAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020679.2-223s1c1
Sequence:CCGGGAGACAGAAGATGGAGAATATCTCGAGATATTCTCCATCTTCTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027162
MIF4GD MISSION shRNA Bacterial Glycerol Stock
MIF4G domain containing
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027162.3-1022s21c1
Sequence:CCGGAGCGCATGGATGAGCTCTTTACTCGAGTAAAGAGCTCATCCATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027162.3-822s21c1
Sequence:CCGGGGTCTGCTATGTCACCTTTATCTCGAGATAAAGGTGACATAGCAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027162.3-689s21c1
Sequence:CCGGGCATGTGCTACGCCATCATTCCTCGAGGAATGATGGCGTAGCACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027162.3-1146s21c1
Sequence:CCGGTCCTGCTGCCCACAAGTATTACTCGAGTAATACTTGTGGGCAGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027162.3-1499s21c1
Sequence:CCGGTGGAATGCTTTGGGATGTTAACTCGAGTTAACATCCCAAAGCATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027162.3-1155s1c1
Sequence:CCGGCCACAAGTATTACTACAGTGACTCGAGTCACTGTAGTAATACTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027162.3-834s1c1
Sequence:CCGGCACCTTTATCTGCAACATCTTCTCGAGAAGATGTTGCAGATAAAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198455    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027162.3-1515s1c1
Sequence:CCGGGTTAAGGGCAAGTTACAAGAACTCGAGTTCTTGTAACTTGCCCTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027162
MIF4GD MISSION shRNA shRNA Plasmid DNA
MIF4G domain containing
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027162.3-1022s21c1
Sequence:CCGGAGCGCATGGATGAGCTCTTTACTCGAGTAAAGAGCTCATCCATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027162.3-822s21c1
Sequence:CCGGGGTCTGCTATGTCACCTTTATCTCGAGATAAAGGTGACATAGCAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027162.3-689s21c1
Sequence:CCGGGCATGTGCTACGCCATCATTCCTCGAGGAATGATGGCGTAGCACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027162.3-1146s21c1
Sequence:CCGGTCCTGCTGCCCACAAGTATTACTCGAGTAATACTTGTGGGCAGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027162.3-1499s21c1
Sequence:CCGGTGGAATGCTTTGGGATGTTAACTCGAGTTAACATCCCAAAGCATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027162.3-1155s1c1
Sequence:CCGGCCACAAGTATTACTACAGTGACTCGAGTCACTGTAGTAATACTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027162.3-834s1c1
Sequence:CCGGCACCTTTATCTGCAACATCTTCTCGAGAAGATGTTGCAGATAAAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198455    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027162.3-1515s1c1
Sequence:CCGGGTTAAGGGCAAGTTACAAGAACTCGAGTTCTTGTAACTTGCCCTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027162
MIF4GD MISSION shRNA Lentiviral Transduction Particles
MIF4G domain containing
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027162.3-1022s21c1
Sequence:CCGGAGCGCATGGATGAGCTCTTTACTCGAGTAAAGAGCTCATCCATGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027162.3-822s21c1
Sequence:CCGGGGTCTGCTATGTCACCTTTATCTCGAGATAAAGGTGACATAGCAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027162.3-689s21c1
Sequence:CCGGGCATGTGCTACGCCATCATTCCTCGAGGAATGATGGCGTAGCACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027162.3-1146s21c1
Sequence:CCGGTCCTGCTGCCCACAAGTATTACTCGAGTAATACTTGTGGGCAGCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027162.3-1499s21c1
Sequence:CCGGTGGAATGCTTTGGGATGTTAACTCGAGTTAACATCCCAAAGCATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027162.3-1155s1c1
Sequence:CCGGCCACAAGTATTACTACAGTGACTCGAGTCACTGTAGTAATACTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027162.3-834s1c1
Sequence:CCGGCACCTTTATCTGCAACATCTTCTCGAGAAGATGTTGCAGATAAAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198455    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027162.3-1515s1c1
Sequence:CCGGGTTAAGGGCAAGTTACAAGAACTCGAGTTCTTGTAACTTGCCCTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)