EMAIL THIS PAGE TO A FRIEND

MIIP

migration and invasion inhibitory protein

80 Gene Product Result for
Synonyms: IIP45
UniProtKB ID: Q5JXC2, C0KL22, Q96HU6, Q9H839, Q9HA00
Gene ID:
Human(60672) Summary: This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]
Mouse(28010) migration and invasion inhibitory protein
Rat(298643) migration and invasion inhibitory protein
chicken(419483) migration and invasion inhibitory protein
dog(608204) migration and invasion inhibitory protein
domestic cat(101101069) migration and invasion inhibitory protein
cow(614193) migration and invasion inhibitory protein
domestic guinea pig(100723827) migration and invasion inhibitory protein
naked mole-rat(101713202) migration and invasion inhibitory protein
sheep(101110255) migration and invasion inhibitory protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021933 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025365 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025365 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025365 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025374 Rosetta Predictions human pricing
NM_021933 Rosetta Predictions human pricing
NM_001017450 Rosetta Predictions rat pricing
NM_001025365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148455 predicted 457
2 SASI_Hs01_00148456 predicted 652
3 SASI_Hs01_00148457 predicted 342
4 SASI_Hs01_00148458 predicted 201
5 SASI_Hs01_00148459 predicted 610
6 SASI_Hs01_00148460 predicted 342
7 SASI_Hs01_00148461 predicted 357
8 SASI_Hs01_00148462 predicted 463
9 SASI_Hs01_00148463 predicted 1512
10 SASI_Hs01_00148464 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158614 predicted 449
2 SASI_Hs02_00355225 predicted 1021
3 SASI_Hs01_00158615 predicted 1326
4 SASI_Hs02_00355226 predicted 1063
5 SASI_Hs02_00355227 predicted 801
6 SASI_Hs02_00355228 predicted 780
7 SASI_Hs02_00355229 predicted 689
8 SASI_Hs01_00158618 predicted 201
9 SASI_Hs01_00158619 predicted 600
10 SASI_Hs02_00355230 predicted 1082
11 SASI_Hs01_00158616 predicted 647
12 SASI_Hs01_00158617 predicted 347
13 SASI_Hs01_00158620 predicted 1185
14 SASI_Hs01_00158621 predicted 343
15 SASI_Hs01_00158622 predicted 352
16 SASI_Hs01_00158623 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017450 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036080 predicted 775
2 SASI_Rn01_00036081 predicted 639
3 SASI_Rn02_00202242 predicted 1090
4 SASI_Rn01_00036083 predicted 1260
5 SASI_Rn01_00036084 predicted 922
6 SASI_Rn01_00036086 predicted 1370
7 SASI_Rn01_00036087 predicted 1116
8 SASI_Rn01_00036088 predicted 788
9 SASI_Rn01_00036089 predicted 315
10 SASI_Rn02_00202243 predicted 672
11 SASI_Rn01_00036082 predicted 1176
12 SASI_Rn01_00036085 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187308 predicted 812
2 SASI_Mm01_00187309 predicted 753
3 SASI_Mm01_00187310 predicted 500
4 SASI_Mm01_00187311 predicted 354
5 SASI_Mm01_00187312 predicted 1126
6 SASI_Mm01_00187313 predicted 1347
7 SASI_Mm01_00187314 predicted 1319
8 SASI_Mm01_00187315 predicted 760
9 SASI_Mm01_00187316 predicted 686
10 SASI_Mm01_00187317 predicted 860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133873
MIIP MISSION shRNA Bacterial Glycerol Stock
migration and invasion inhibitory protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000195776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133873.1-768s1c1
Sequence:CCGGCTTCTCTATGCTGCAGAGGTTCTCGAGAACCTCTGCAGCATAGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133873.1-801s1c1
Sequence:CCGGCAAAGAGGATTGTGTTTGCAACTCGAGTTGCAAACACAATCCTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133873.1-275s1c1
Sequence:CCGGCAGGGTCAAACTTGGATTGTACTCGAGTACAATCCAAGTTTGACCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133873.1-700s1c1
Sequence:CCGGCTAGGCTATGATTGGATTGCACTCGAGTGCAATCCAATCATAGCCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133873
MIIP MISSION shRNA shRNA Plasmid DNA
migration and invasion inhibitory protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000195776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133873.1-768s1c1
Sequence:CCGGCTTCTCTATGCTGCAGAGGTTCTCGAGAACCTCTGCAGCATAGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133873.1-801s1c1
Sequence:CCGGCAAAGAGGATTGTGTTTGCAACTCGAGTTGCAAACACAATCCTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133873.1-275s1c1
Sequence:CCGGCAGGGTCAAACTTGGATTGTACTCGAGTACAATCCAAGTTTGACCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133873.1-700s1c1
Sequence:CCGGCTAGGCTATGATTGGATTGCACTCGAGTGCAATCCAATCATAGCCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133873
MIIP MISSION shRNA Lentiviral Transduction Particles
migration and invasion inhibitory protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000195776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133873.1-768s1c1
Sequence:CCGGCTTCTCTATGCTGCAGAGGTTCTCGAGAACCTCTGCAGCATAGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133873.1-801s1c1
Sequence:CCGGCAAAGAGGATTGTGTTTGCAACTCGAGTTGCAAACACAATCCTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133873.1-275s1c1
Sequence:CCGGCAGGGTCAAACTTGGATTGTACTCGAGTACAATCCAAGTTTGACCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133873.1-700s1c1
Sequence:CCGGCTAGGCTATGATTGGATTGCACTCGAGTGCAATCCAATCATAGCCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021933
VALIDATED
MIIP MISSION shRNA Bacterial Glycerol Stock
migration and invasion inhibitory protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021933.1-703s1c1
Sequence:CCGGGCTATGACTGGATTGCAGTGTCTCGAGACACTGCAATCCAGTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021933.1-885s1c1
Sequence:CCGGGAATGCGTGTACTGTTACCGTCTCGAGACGGTAACAGTACACGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021933.2-802s21c1
Sequence:CCGGACCAACAAGGAGGAGTGTATCCTCGAGGATACACTCCTCCTTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021933.2-876s21c1
Sequence:CCGGCGTGGAGGAAGACCATGAATGCTCGAGCATTCATGGTCTTCCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021933.2-661s21c1
Sequence:CCGGGAGGAGTCTGCAGTTCCTAAGCTCGAGCTTAGGAACTGCAGACTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021933.2-898s21c1
Sequence:CCGGGTGTACTGTTACCGTGTCAACCTCGAGGTTGACACGGTAACAGTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021933.2-776s21c1
Sequence:CCGGTCTCCAAGCTGCAGGAGTTTCCTCGAGGAAACTCCTGCAGCTTGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021933
VALIDATED
MIIP MISSION shRNA shRNA Plasmid DNA
migration and invasion inhibitory protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021933.1-703s1c1
Sequence:CCGGGCTATGACTGGATTGCAGTGTCTCGAGACACTGCAATCCAGTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021933.1-885s1c1
Sequence:CCGGGAATGCGTGTACTGTTACCGTCTCGAGACGGTAACAGTACACGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021933.2-802s21c1
Sequence:CCGGACCAACAAGGAGGAGTGTATCCTCGAGGATACACTCCTCCTTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021933.2-876s21c1
Sequence:CCGGCGTGGAGGAAGACCATGAATGCTCGAGCATTCATGGTCTTCCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021933.2-661s21c1
Sequence:CCGGGAGGAGTCTGCAGTTCCTAAGCTCGAGCTTAGGAACTGCAGACTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021933.2-898s21c1
Sequence:CCGGGTGTACTGTTACCGTGTCAACCTCGAGGTTGACACGGTAACAGTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021933.2-776s21c1
Sequence:CCGGTCTCCAAGCTGCAGGAGTTTCCTCGAGGAAACTCCTGCAGCTTGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021933
VALIDATED
MIIP MISSION shRNA Lentiviral Transduction Particles
migration and invasion inhibitory protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021933.1-703s1c1
Sequence:CCGGGCTATGACTGGATTGCAGTGTCTCGAGACACTGCAATCCAGTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021933.1-885s1c1
Sequence:CCGGGAATGCGTGTACTGTTACCGTCTCGAGACGGTAACAGTACACGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021933.2-802s21c1
Sequence:CCGGACCAACAAGGAGGAGTGTATCCTCGAGGATACACTCCTCCTTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021933.2-876s21c1
Sequence:CCGGCGTGGAGGAAGACCATGAATGCTCGAGCATTCATGGTCTTCCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021933.2-661s21c1
Sequence:CCGGGAGGAGTCTGCAGTTCCTAAGCTCGAGCTTAGGAACTGCAGACTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021933.2-898s21c1
Sequence:CCGGGTGTACTGTTACCGTGTCAACCTCGAGGTTGACACGGTAACAGTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021933.2-776s21c1
Sequence:CCGGTCTCCAAGCTGCAGGAGTTTCCTCGAGGAAACTCCTGCAGCTTGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025365
VALIDATED
MIIP MISSION shRNA Bacterial Glycerol Stock
migration and invasion inhibitory protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025365.2-1655s21c1
Sequence:CCGGAGAGCTGGAAGTGGAGAAGATCTCGAGATCTTCTCCACTTCCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025365.2-863s21c1
Sequence:CCGGGTCCATCCTGTCACGACTAAGCTCGAGCTTAGTCGTGACAGGATGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025365.2-1125s21c1
Sequence:CCGGGAAGAGGACCACGAGTGTATGCTCGAGCATACACTCGTGGTCCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025365.2-950s21c1
Sequence:CCGGGCCATACCTAGGCTATGATTGCTCGAGCAATCATAGCCTAGGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025365.2-655s21c1
Sequence:CCGGGTCGTCGAGATGACACGTTTGCTCGAGCAAACGTGTCATCTCGACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025365.2-1595s21c1
Sequence:CCGGGGCCCAGAAGACAACAGTATTCTCGAGAATACTGTTGTCTTCTGGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025365.2-677s21c1
Sequence:CCGGTGTGGCCTGGTATGTCAAGTTCTCGAGAACTTGACATACCAGGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025365.2-1340s21c1
Sequence:CCGGTGCATCTGACACTCTAGCTTTCTCGAGAAAGCTAGAGTGTCAGATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025365.2-1298s21c1
Sequence:CCGGCCCTCCACACCAGTATCGAATCTCGAGATTCGATACTGGTGTGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025365
VALIDATED
MIIP MISSION shRNA shRNA Plasmid DNA
migration and invasion inhibitory protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025365.2-1655s21c1
Sequence:CCGGAGAGCTGGAAGTGGAGAAGATCTCGAGATCTTCTCCACTTCCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025365.2-863s21c1
Sequence:CCGGGTCCATCCTGTCACGACTAAGCTCGAGCTTAGTCGTGACAGGATGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025365.2-1125s21c1
Sequence:CCGGGAAGAGGACCACGAGTGTATGCTCGAGCATACACTCGTGGTCCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025365.2-950s21c1
Sequence:CCGGGCCATACCTAGGCTATGATTGCTCGAGCAATCATAGCCTAGGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025365.2-655s21c1
Sequence:CCGGGTCGTCGAGATGACACGTTTGCTCGAGCAAACGTGTCATCTCGACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025365.2-1595s21c1
Sequence:CCGGGGCCCAGAAGACAACAGTATTCTCGAGAATACTGTTGTCTTCTGGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025365.2-677s21c1
Sequence:CCGGTGTGGCCTGGTATGTCAAGTTCTCGAGAACTTGACATACCAGGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025365.2-1340s21c1
Sequence:CCGGTGCATCTGACACTCTAGCTTTCTCGAGAAAGCTAGAGTGTCAGATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025365.2-1298s21c1
Sequence:CCGGCCCTCCACACCAGTATCGAATCTCGAGATTCGATACTGGTGTGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025365
VALIDATED
MIIP MISSION shRNA Lentiviral Transduction Particles
migration and invasion inhibitory protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025365.2-1655s21c1
Sequence:CCGGAGAGCTGGAAGTGGAGAAGATCTCGAGATCTTCTCCACTTCCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025365.2-863s21c1
Sequence:CCGGGTCCATCCTGTCACGACTAAGCTCGAGCTTAGTCGTGACAGGATGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025365.2-1125s21c1
Sequence:CCGGGAAGAGGACCACGAGTGTATGCTCGAGCATACACTCGTGGTCCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025365.2-950s21c1
Sequence:CCGGGCCATACCTAGGCTATGATTGCTCGAGCAATCATAGCCTAGGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025365.2-655s21c1
Sequence:CCGGGTCGTCGAGATGACACGTTTGCTCGAGCAAACGTGTCATCTCGACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025365.2-1595s21c1
Sequence:CCGGGGCCCAGAAGACAACAGTATTCTCGAGAATACTGTTGTCTTCTGGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025365.2-677s21c1
Sequence:CCGGTGTGGCCTGGTATGTCAAGTTCTCGAGAACTTGACATACCAGGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025365.2-1340s21c1
Sequence:CCGGTGCATCTGACACTCTAGCTTTCTCGAGAAAGCTAGAGTGTCAGATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025365.2-1298s21c1
Sequence:CCGGCCCTCCACACCAGTATCGAATCTCGAGATTCGATACTGGTGTGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)