EMAIL THIS PAGE TO A FRIEND

MINA

MYC induced nuclear antigen

173 Gene Product Result for
Synonyms: MDIG MINA53 NO52 ROX
Gene ID:
Human(84864) Summary: MINA is a c-Myc (MYC; MIM 190080) target gene that may play a role in cell proliferation or regulation of cell growth. (Tsuneoka et al., 2002 [PubMed 12091391]
Mouse(67014) myc induced nuclear antigen
Rat(266670) myc induced nuclear antigen
chicken(418436) MYC induced nuclear antigen
cow(540466) MYC induced nuclear antigen
Horse(100072544) MYC induced nuclear antigen
dog(478533) MYC induced nuclear antigen
domestic cat(101082510) MYC induced nuclear antigen
naked mole-rat(101726082) MYC induced nuclear antigen
domestic guinea pig(100723333) MYC induced nuclear antigen
sheep(101103688) MYC induced nuclear antigen
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025910 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025910 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025910 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032778 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032778 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032778 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU006991 MISSION® esiRNA esiRNA targeting mouse Mina (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042533 Rosetta Predictions human pricing
NM_032778 Rosetta Predictions human pricing
NM_153182 Rosetta Predictions human pricing
NM_153309 Rosetta Predictions rat pricing
NM_025910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310408 predicted 723
2 SASI_Hs02_00310409 predicted 787
3 SASI_Hs02_00310410 predicted 1627
4 SASI_Hs02_00310411 predicted 1634
5 SASI_Hs02_00310412 predicted 921
6 SASI_Hs02_00310413 predicted 1596
7 SASI_Hs02_00310414 predicted 1909
8 SASI_Hs02_00310415 predicted 1677
9 SASI_Hs02_00310416 predicted 1733
10 SASI_Hs02_00310417 predicted 1996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360324 predicted 722
2 SASI_Hs01_00051338 predicted 786
3 SASI_Hs01_00051340 predicted 1623
4 SASI_Hs02_00360325 predicted 1636
5 SASI_Hs01_00051342 predicted 926
6 SASI_Hs02_00360326 predicted 1597
7 SASI_Hs02_00360327 predicted 1904
8 SASI_Hs02_00360328 predicted 1668
9 SASI_Hs02_00360329 predicted 1726
10 SASI_Hs02_00360330 predicted 1992
11 SASI_Hs01_00051339 predicted 1292
12 SASI_Hs01_00051341 predicted 1120
13 SASI_Hs01_00051343 predicted 1567
14 SASI_Hs01_00051344 predicted 1263
15 SASI_Hs01_00051345 predicted 463
16 SASI_Hs01_00051346 predicted 1599
17 SASI_Hs01_00051347 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367010 predicted 333
2 SASI_Hs01_00045958 predicted 393
3 SASI_Hs02_00367011 predicted 1227
4 SASI_Hs02_00367012 predicted 1243
5 SASI_Hs01_00045960 predicted 532
6 SASI_Hs02_00367013 predicted 1206
7 SASI_Hs02_00367014 predicted 1512
8 SASI_Hs02_00367015 predicted 1279
9 SASI_Hs02_00367016 predicted 1338
10 SASI_Hs02_00367017 predicted 1591
11 SASI_Hs01_00045959 predicted 263
12 SASI_Hs01_00045961 predicted 719
13 SASI_Hs01_00045962 predicted 512
14 SASI_Hs01_00045963 predicted 883
15 SASI_Hs01_00045964 predicted 804
16 SASI_Hs01_00045965 predicted 508
17 SASI_Hs01_00045966 predicted 244
18 SASI_Hs01_00045967 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153309 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033861 predicted 1280
2 SASI_Rn01_00033862 predicted 1444
3 SASI_Rn01_00033863 predicted 1361
4 SASI_Rn01_00033864 predicted 329
5 SASI_Rn01_00033865 predicted 1453
6 SASI_Rn01_00033866 predicted 1220
7 SASI_Rn01_00033867 predicted 570
8 SASI_Rn01_00033869 predicted 809
9 SASI_Rn01_00033870 predicted 1106
10 SASI_Rn02_00268956 predicted 1126
11 SASI_Rn01_00033868 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158059 predicted 852
2 SASI_Mm02_00329264 predicted 1194
3 SASI_Mm01_00158060 predicted 1135
4 SASI_Mm01_00158061 predicted 1467
5 SASI_Mm02_00329265 predicted 1210
6 SASI_Mm01_00158062 predicted 664
7 SASI_Mm01_00158063 predicted 523
8 SASI_Mm01_00158064 predicted 1835
9 SASI_Mm02_00329266 predicted 1161
10 SASI_Mm01_00158065 predicted 1030
11 SASI_Mm01_00158066 predicted 1767
12 SASI_Mm01_00158067 predicted 1299
13 SASI_Mm01_00158068 predicted 934
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025910
VALIDATED
MINA MISSION shRNA Bacterial Glycerol Stock
MYC induced nuclear antigen
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025910.2-1525s21c1
Sequence:CCGGGCCAAGGTTGGACAACATAATCTCGAGATTATGTTGTCCAACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025910.2-536s1c1
Sequence:CCGGGAAACGCTTTCTGTATTAAACCTCGAGGTTTAATACAGAAAGCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025910.2-1204s1c1
Sequence:CCGGCTCTATTCACCTGACTATTAGCTCGAGCTAATAGTCAGGTGAATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025910.2-1293s1c1
Sequence:CCGGCAAAGGAAGATGTGGCATTAACTCGAGTTAATGCCACATCTTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025910.2-738s21c1
Sequence:CCGGACTATGGAAGAGACGTGAATGCTCGAGCATTCACGTCTCTTCCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025910.2-1854s21c1
Sequence:CCGGGCCTTTATGCAGAGAATTGTTCTCGAGAACAATTCTCTGCATAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025910.2-567s21c1
Sequence:CCGGCCAGTAGTTTCTTCGAAAGTTCTCGAGAACTTTCGAAGAAACTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025910.2-1190s21c1
Sequence:CCGGTCAGGCCTGGCCTACTCTATTCTCGAGAATAGAGTAGGCCAGGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025910.2-851s1c1
Sequence:CCGGGCAACAATTCAGTTTCACCAACTCGAGTTGGTGAAACTGAATTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025910.2-1763s1c1
Sequence:CCGGCGTGTTAAGGAACTGAAACTTCTCGAGAAGTTTCAGTTCCTTAACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025910.2-2054s1c1
Sequence:CCGGCGGACAAGTTTATTTAATGCACTCGAGTGCATTAAATAAACTTGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025910.2-1525s1c1
Sequence:CCGGGCCAAGGTTGGACAACATAATCTCGAGATTATGTTGTCCAACCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025910.2-1854s1c1
Sequence:CCGGGCCTTTATGCAGAGAATTGTTCTCGAGAACAATTCTCTGCATAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025910.2-567s1c1
Sequence:CCGGCCAGTAGTTTCTTCGAAAGTTCTCGAGAACTTTCGAAGAAACTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025910
VALIDATED
MINA MISSION shRNA shRNA Plasmid DNA
MYC induced nuclear antigen
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025910.2-1525s21c1
Sequence:CCGGGCCAAGGTTGGACAACATAATCTCGAGATTATGTTGTCCAACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025910.2-536s1c1
Sequence:CCGGGAAACGCTTTCTGTATTAAACCTCGAGGTTTAATACAGAAAGCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025910.2-1204s1c1
Sequence:CCGGCTCTATTCACCTGACTATTAGCTCGAGCTAATAGTCAGGTGAATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025910.2-1293s1c1
Sequence:CCGGCAAAGGAAGATGTGGCATTAACTCGAGTTAATGCCACATCTTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025910.2-738s21c1
Sequence:CCGGACTATGGAAGAGACGTGAATGCTCGAGCATTCACGTCTCTTCCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025910.2-1854s21c1
Sequence:CCGGGCCTTTATGCAGAGAATTGTTCTCGAGAACAATTCTCTGCATAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025910.2-567s21c1
Sequence:CCGGCCAGTAGTTTCTTCGAAAGTTCTCGAGAACTTTCGAAGAAACTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025910.2-1190s21c1
Sequence:CCGGTCAGGCCTGGCCTACTCTATTCTCGAGAATAGAGTAGGCCAGGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025910.2-851s1c1
Sequence:CCGGGCAACAATTCAGTTTCACCAACTCGAGTTGGTGAAACTGAATTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025910.2-1763s1c1
Sequence:CCGGCGTGTTAAGGAACTGAAACTTCTCGAGAAGTTTCAGTTCCTTAACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025910.2-2054s1c1
Sequence:CCGGCGGACAAGTTTATTTAATGCACTCGAGTGCATTAAATAAACTTGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025910.2-1525s1c1
Sequence:CCGGGCCAAGGTTGGACAACATAATCTCGAGATTATGTTGTCCAACCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025910.2-1854s1c1
Sequence:CCGGGCCTTTATGCAGAGAATTGTTCTCGAGAACAATTCTCTGCATAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025910.2-567s1c1
Sequence:CCGGCCAGTAGTTTCTTCGAAAGTTCTCGAGAACTTTCGAAGAAACTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025910
VALIDATED
MINA MISSION shRNA Lentiviral Transduction Particles
MYC induced nuclear antigen
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025910.2-1525s21c1
Sequence:CCGGGCCAAGGTTGGACAACATAATCTCGAGATTATGTTGTCCAACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025910.2-536s1c1
Sequence:CCGGGAAACGCTTTCTGTATTAAACCTCGAGGTTTAATACAGAAAGCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025910.2-1204s1c1
Sequence:CCGGCTCTATTCACCTGACTATTAGCTCGAGCTAATAGTCAGGTGAATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025910.2-1293s1c1
Sequence:CCGGCAAAGGAAGATGTGGCATTAACTCGAGTTAATGCCACATCTTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025910.2-738s21c1
Sequence:CCGGACTATGGAAGAGACGTGAATGCTCGAGCATTCACGTCTCTTCCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025910.2-1854s21c1
Sequence:CCGGGCCTTTATGCAGAGAATTGTTCTCGAGAACAATTCTCTGCATAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025910.2-567s21c1
Sequence:CCGGCCAGTAGTTTCTTCGAAAGTTCTCGAGAACTTTCGAAGAAACTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025910.2-1190s21c1
Sequence:CCGGTCAGGCCTGGCCTACTCTATTCTCGAGAATAGAGTAGGCCAGGCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025910.2-851s1c1
Sequence:CCGGGCAACAATTCAGTTTCACCAACTCGAGTTGGTGAAACTGAATTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025910.2-1763s1c1
Sequence:CCGGCGTGTTAAGGAACTGAAACTTCTCGAGAAGTTTCAGTTCCTTAACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025910.2-2054s1c1
Sequence:CCGGCGGACAAGTTTATTTAATGCACTCGAGTGCATTAAATAAACTTGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025910.2-1525s1c1
Sequence:CCGGGCCAAGGTTGGACAACATAATCTCGAGATTATGTTGTCCAACCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025910.2-1854s1c1
Sequence:CCGGGCCTTTATGCAGAGAATTGTTCTCGAGAACAATTCTCTGCATAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025910.2-567s1c1
Sequence:CCGGCCAGTAGTTTCTTCGAAAGTTCTCGAGAACTTTCGAAGAAACTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032778
VALIDATED
MINA MISSION shRNA Bacterial Glycerol Stock
MYC induced nuclear antigen
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032778.4-558s21c1
Sequence:CCGGCCCTGTAAGCAGATGAAGTTACTCGAGTAACTTCATCTGCTTACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032778.4-1188s21c1
Sequence:CCGGCCGGGTGATTTGTTGTACTTTCTCGAGAAAGTACAACAAATCACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_032778.4-903s21c1
Sequence:CCGGGCAACGATTCAGTTTCACCAACTCGAGTTGGTGAAACTGAATCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032778.4-647s21c1
Sequence:CCGGGCCCATCAAGACAGAGACTTTCTCGAGAAAGTCTCTGTCTTGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_032778.4-2014s21c1
Sequence:CCGGCAAACATGAGACCTCCCTGTTCTCGAGAACAGGGAGGTCTCATGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032778.3-1693s1c1
Sequence:CCGGCAAGTTTCCTTACCTGCGTATCTCGAGATACGCAGGTAAGGAAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130154    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032778.3-1612s1c1
Sequence:CCGGCTTTGCAGAATCAAATGCCTACTCGAGTAGGCATTTGATTCTGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032778.3-1721s1c1
Sequence:CCGGCAAACATGAGACCTCCCTGTTCTCGAGAACAGGGAGGTCTCATGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032778.3-1759s1c1
Sequence:CCGGCAAATGTACTAACGGGCACATCTCGAGATGTGCCCGTTAGTACATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-265s1c1
Sequence:CCGGCCCTGTAAGCAGATGAAGTTACTCGAGTAACTTCATCTGCTTACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032778.3-1896s1c1
Sequence:CCGGGAATGTCATTAACCTGGCTTTCTCGAGAAAGCCAGGTTAATGACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-1528s1c2
Sequence:CCGGGACCTGAAACTTACTACAGATCTCGAGATCTGTAGTAAGTTTCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032778.3-1616s1c1
Sequence:CCGGGCAGAATCAAATGCCTACTATCTCGAGATAGTAGGCATTTGATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-610s1c1
Sequence:CCGGGCAACGATTCAGTTTCACCAACTCGAGTTGGTGAAACTGAATCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-1528s1c1
Sequence:CCGGGACCTGAAACTTACTACAGATCTCGAGATCTGTAGTAAGTTTCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-354s1c1
Sequence:CCGGGCCCATCAAGACAGAGACTTTCTCGAGAAAGTCTCTGTCTTGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-895s1c1
Sequence:CCGGCCGGGTGATTTGTTGTACTTTCTCGAGAAAGTACAACAAATCACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032778
VALIDATED
MINA MISSION shRNA shRNA Plasmid DNA
MYC induced nuclear antigen
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032778.4-558s21c1
Sequence:CCGGCCCTGTAAGCAGATGAAGTTACTCGAGTAACTTCATCTGCTTACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032778.4-1188s21c1
Sequence:CCGGCCGGGTGATTTGTTGTACTTTCTCGAGAAAGTACAACAAATCACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_032778.4-903s21c1
Sequence:CCGGGCAACGATTCAGTTTCACCAACTCGAGTTGGTGAAACTGAATCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032778.4-647s21c1
Sequence:CCGGGCCCATCAAGACAGAGACTTTCTCGAGAAAGTCTCTGTCTTGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_032778.4-2014s21c1
Sequence:CCGGCAAACATGAGACCTCCCTGTTCTCGAGAACAGGGAGGTCTCATGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032778.3-1693s1c1
Sequence:CCGGCAAGTTTCCTTACCTGCGTATCTCGAGATACGCAGGTAAGGAAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130154    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032778.3-1612s1c1
Sequence:CCGGCTTTGCAGAATCAAATGCCTACTCGAGTAGGCATTTGATTCTGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032778.3-1721s1c1
Sequence:CCGGCAAACATGAGACCTCCCTGTTCTCGAGAACAGGGAGGTCTCATGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032778.3-1759s1c1
Sequence:CCGGCAAATGTACTAACGGGCACATCTCGAGATGTGCCCGTTAGTACATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-265s1c1
Sequence:CCGGCCCTGTAAGCAGATGAAGTTACTCGAGTAACTTCATCTGCTTACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032778.3-1896s1c1
Sequence:CCGGGAATGTCATTAACCTGGCTTTCTCGAGAAAGCCAGGTTAATGACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-1528s1c2
Sequence:CCGGGACCTGAAACTTACTACAGATCTCGAGATCTGTAGTAAGTTTCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032778.3-1616s1c1
Sequence:CCGGGCAGAATCAAATGCCTACTATCTCGAGATAGTAGGCATTTGATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-610s1c1
Sequence:CCGGGCAACGATTCAGTTTCACCAACTCGAGTTGGTGAAACTGAATCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-1528s1c1
Sequence:CCGGGACCTGAAACTTACTACAGATCTCGAGATCTGTAGTAAGTTTCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-354s1c1
Sequence:CCGGGCCCATCAAGACAGAGACTTTCTCGAGAAAGTCTCTGTCTTGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-895s1c1
Sequence:CCGGCCGGGTGATTTGTTGTACTTTCTCGAGAAAGTACAACAAATCACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032778
VALIDATED
MINA MISSION shRNA Lentiviral Transduction Particles
MYC induced nuclear antigen
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032778.4-558s21c1
Sequence:CCGGCCCTGTAAGCAGATGAAGTTACTCGAGTAACTTCATCTGCTTACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032778.4-1188s21c1
Sequence:CCGGCCGGGTGATTTGTTGTACTTTCTCGAGAAAGTACAACAAATCACCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_032778.4-903s21c1
Sequence:CCGGGCAACGATTCAGTTTCACCAACTCGAGTTGGTGAAACTGAATCGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032778.4-647s21c1
Sequence:CCGGGCCCATCAAGACAGAGACTTTCTCGAGAAAGTCTCTGTCTTGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_032778.4-2014s21c1
Sequence:CCGGCAAACATGAGACCTCCCTGTTCTCGAGAACAGGGAGGTCTCATGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032778.3-1693s1c1
Sequence:CCGGCAAGTTTCCTTACCTGCGTATCTCGAGATACGCAGGTAAGGAAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130154    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032778.3-1612s1c1
Sequence:CCGGCTTTGCAGAATCAAATGCCTACTCGAGTAGGCATTTGATTCTGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032778.3-1721s1c1
Sequence:CCGGCAAACATGAGACCTCCCTGTTCTCGAGAACAGGGAGGTCTCATGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032778.3-1759s1c1
Sequence:CCGGCAAATGTACTAACGGGCACATCTCGAGATGTGCCCGTTAGTACATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-265s1c1
Sequence:CCGGCCCTGTAAGCAGATGAAGTTACTCGAGTAACTTCATCTGCTTACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032778.3-1896s1c1
Sequence:CCGGGAATGTCATTAACCTGGCTTTCTCGAGAAAGCCAGGTTAATGACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-1528s1c2
Sequence:CCGGGACCTGAAACTTACTACAGATCTCGAGATCTGTAGTAAGTTTCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032778.3-1616s1c1
Sequence:CCGGGCAGAATCAAATGCCTACTATCTCGAGATAGTAGGCATTTGATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-610s1c1
Sequence:CCGGGCAACGATTCAGTTTCACCAACTCGAGTTGGTGAAACTGAATCGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-1528s1c1
Sequence:CCGGGACCTGAAACTTACTACAGATCTCGAGATCTGTAGTAAGTTTCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-354s1c1
Sequence:CCGGGCCCATCAAGACAGAGACTTTCTCGAGAAAGTCTCTGTCTTGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032778.3-895s1c1
Sequence:CCGGCCGGGTGATTTGTTGTACTTTCTCGAGAAAGTACAACAAATCACCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)