EMAIL THIS PAGE TO A FRIEND

MINK1

misshapen-like kinase 1

221 Gene Product Result for
Synonyms: B55 MAP4K6 MINK YSK2 ZC3 hMINK hMINKbeta
UniProtKB ID: Q8N4C8, D3DTK3, D3DTK4, Q5U8Z0, Q9P1X1, Q9P2R8
Gene ID:
Human(50488) Summary: This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. Alternative splicing occurs at this locus and four transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(50932) misshapen-like kinase 1 (zebrafish)
Rat(303259) misshapen-like kinase 1
Zebrafish(100038799) misshapen-like kinase 1
domestic cat(101092806) misshapen-like kinase 1
Horse(100061370) misshapen-like kinase 1
cow(519558) misshapen-like kinase 1
dog(100686834) misshapen-like kinase 1
sheep(101115556) misshapen-like kinase 1
domestic guinea pig(100721691) misshapen-like kinase 1
naked mole-rat(101713876) misshapen-like kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015716 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016713 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016713 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016713 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024937 Rosetta Predictions human pricing
NM_015716 Rosetta Predictions human pricing
NM_153827 Rosetta Predictions human pricing
NM_170663 Rosetta Predictions human pricing
XM_001079459 Rosetta Predictions rat pricing
NM_001045959 Rosetta Predictions mouse pricing
NM_001045964 Rosetta Predictions mouse pricing
NM_016713 Rosetta Predictions mouse pricing
NM_176893 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024230 predicted 3509
2 SASI_Hs01_00024231 predicted 509
3 SASI_Hs01_00024232 predicted 991
4 SASI_Hs01_00024233 predicted 964
5 SASI_Hs01_00024234 predicted 3892
6 SASI_Hs01_00024235 predicted 3398
7 SASI_Hs01_00024237 predicted 3162
8 SASI_Hs01_00024239 predicted 955
9 SASI_Hs02_00307271 predicted 3493
10 SASI_Hs02_00307272 predicted 834
11 SASI_Hs01_00024236 predicted 1005
12 SASI_Hs01_00024238 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048370 predicted 3458
2 SASI_Hs01_00048371 predicted 507
3 SASI_Hs01_00048372 predicted 994
4 SASI_Hs01_00048373 predicted 965
5 SASI_Hs01_00048374 predicted 3848
6 SASI_Hs01_00048375 predicted 3354
7 SASI_Hs01_00048377 predicted 3112
8 SASI_Hs01_00048379 predicted 951
9 SASI_Hs02_00348399 predicted 3445
10 SASI_Hs02_00348400 predicted 828
11 SASI_Hs01_00048376 predicted 1001
12 SASI_Hs01_00048378 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090659 predicted 3570
2 SASI_Hs01_00090660 predicted 513
3 SASI_Hs01_00090661 predicted 990
4 SASI_Hs01_00090662 predicted 963
5 SASI_Hs01_00090663 predicted 3950
6 SASI_Hs01_00090664 predicted 3463
7 SASI_Hs01_00090666 predicted 3225
8 SASI_Hs01_00090668 predicted 953
9 SASI_Hs02_00367510 predicted 3548
10 SASI_Hs02_00367511 predicted 834
11 SASI_Hs01_00090665 predicted 1002
12 SASI_Hs01_00090667 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123651 predicted 3479
2 SASI_Hs01_00123652 predicted 508
3 SASI_Hs01_00123653 predicted 990
4 SASI_Hs01_00123654 predicted 968
5 SASI_Hs01_00123655 predicted 3868
6 SASI_Hs01_00123656 predicted 3372
7 SASI_Hs01_00123658 predicted 3142
8 SASI_Hs01_00123660 predicted 955
9 SASI_Hs02_00367570 predicted 3463
10 SASI_Hs02_00367571 predicted 834
11 SASI_Hs01_00123657 predicted 1000
12 SASI_Hs01_00123659 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364438 predicted 958
2 SASI_Rn02_00364439 predicted 384
3 SASI_Rn02_00364440 predicted 3372
4 SASI_Rn02_00364441 predicted 3274
5 SASI_Rn02_00364442 predicted 552
6 SASI_Rn02_00364443 predicted 993
7 SASI_Rn02_00364444 predicted 1961
8 SASI_Rn02_00364445 predicted 2928
9 SASI_Rn02_00364446 predicted 814
10 SASI_Rn02_00364447 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291861 predicted 953
2 SASI_Mm02_00291862 predicted 682
3 SASI_Mm02_00291863 predicted 3034
4 SASI_Mm02_00291864 predicted 3562
5 SASI_Mm02_00291865 predicted 1959
6 SASI_Mm02_00291866 predicted 3381
7 SASI_Mm02_00291867 predicted 420
8 SASI_Mm02_00291868 predicted 553
9 SASI_Mm02_00291869 predicted 3233
10 SASI_Mm02_00291870 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291871 predicted 953
2 SASI_Mm02_00291872 predicted 682
3 SASI_Mm02_00291873 predicted 3062
4 SASI_Mm02_00291874 predicted 3581
5 SASI_Mm02_00291875 predicted 1957
6 SASI_Mm02_00291876 predicted 3398
7 SASI_Mm02_00291877 predicted 424
8 SASI_Mm02_00291878 predicted 558
9 SASI_Mm02_00291879 predicted 3257
10 SASI_Mm02_00291880 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036510 predicted 960
2 SASI_Mm01_00036511 predicted 679
3 SASI_Mm01_00036512 predicted 2929
4 SASI_Mm01_00036513 predicted 3446
5 SASI_Mm01_00036515 predicted 1955
6 SASI_Mm01_00036516 predicted 3272
7 SASI_Mm01_00036517 predicted 418
8 SASI_Mm01_00036518 predicted 550
9 SASI_Mm01_00036519 predicted 3118
10 SASI_Mm02_00323405 predicted 567
11 SASI_Mm01_00036514 predicted 2841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121578 predicted 956
2 SASI_Mm01_00121579 predicted 683
3 SASI_Mm01_00121580 predicted 2949
4 SASI_Mm01_00121581 predicted 3471
5 SASI_Mm01_00121583 predicted 1963
6 SASI_Mm01_00121584 predicted 3299
7 SASI_Mm01_00121585 predicted 424
8 SASI_Mm01_00121586 predicted 558
9 SASI_Mm01_00121587 predicted 3147
10 SASI_Mm02_00346780 predicted 567
11 SASI_Mm01_00121582 predicted 2861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015716
VALIDATED
MINK1 MISSION shRNA Bacterial Glycerol Stock
misshapen-like kinase 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015716.2-2483s1c1
Sequence:CCGGGCAGACTTTGTGTTGCTGAAACTCGAGTTTCAGCAACACAAAGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_015716.2-3118s1c1
Sequence:CCGGCCGGAAGTACAAGAAGCGATTCTCGAGAATCGCTTCTTGTACTTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015716.2-1042s1c1
Sequence:CCGGGCTACTGAAGTTTCCCTTCATCTCGAGATGAAGGGAAACTTCAGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015716.2-3460s1c1
Sequence:CCGGGCGGATTAAGTTCCTGGTCATCTCGAGATGACCAGGAACTTAATCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_015716.2-4334s1c1
Sequence:CCGGCCCAGGAATTGAGTGGGCCTACTCGAGTAGGCCCACTCAATTCCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015716.2-4231s1c1
Sequence:CCGGCCCTGATGCTTTCGTGATCACCTCGAGGTGATCACGAAAGCATCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015716.2-4239s1c1
Sequence:CCGGCTTTCGTGATCACGTGACCATCTCGAGATGGTCACGTGATCACGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015716.2-4057s1c1
Sequence:CCGGGAACCGTAACTGCATCATGAACTCGAGTTCATGATGCAGTTACGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015716.2-3808s1c1
Sequence:CCGGGCGCATCATTAAGGATGTGGTCTCGAGACCACATCCTTAATGATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015716.3-3321s21c1
Sequence:GTACCGGGGAACAAACTGCGGGTGTATTCTCGAGAATACACCCGCAGTTTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015716.3-2928s21c1
Sequence:GTACCGGAGAGCTCGTTCACGATGTTTGCTCGAGCAAACATCGTGAACGAGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015716.3-3460s21c1
Sequence:CCGGGCGGATTAAGTTCCTGGTCATCTCGAGATGACCAGGAACTTAATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015716.3-4231s21c1
Sequence:CCGGCCCTGATGCTTTCGTGATCACCTCGAGGTGATCACGAAAGCATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015716.3-1042s21c1
Sequence:CCGGGCTACTGAAGTTTCCCTTCATCTCGAGATGAAGGGAAACTTCAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015716.3-575s21c1
Sequence:CCGGGAGGACTGTATCGCCTATATCCTCGAGGATATAGGCGATACAGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015716.3-3609s21c1
Sequence:CCGGAGCGGCTCAAGGTCATCTATGCTCGAGCATAGATGACCTTGAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015716
VALIDATED
MINK1 MISSION shRNA shRNA Plasmid DNA
misshapen-like kinase 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015716.2-2483s1c1
Sequence:CCGGGCAGACTTTGTGTTGCTGAAACTCGAGTTTCAGCAACACAAAGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_015716.2-3118s1c1
Sequence:CCGGCCGGAAGTACAAGAAGCGATTCTCGAGAATCGCTTCTTGTACTTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015716.2-1042s1c1
Sequence:CCGGGCTACTGAAGTTTCCCTTCATCTCGAGATGAAGGGAAACTTCAGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015716.2-3460s1c1
Sequence:CCGGGCGGATTAAGTTCCTGGTCATCTCGAGATGACCAGGAACTTAATCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_015716.2-4334s1c1
Sequence:CCGGCCCAGGAATTGAGTGGGCCTACTCGAGTAGGCCCACTCAATTCCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015716.2-4231s1c1
Sequence:CCGGCCCTGATGCTTTCGTGATCACCTCGAGGTGATCACGAAAGCATCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015716.2-4239s1c1
Sequence:CCGGCTTTCGTGATCACGTGACCATCTCGAGATGGTCACGTGATCACGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015716.2-4057s1c1
Sequence:CCGGGAACCGTAACTGCATCATGAACTCGAGTTCATGATGCAGTTACGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015716.2-3808s1c1
Sequence:CCGGGCGCATCATTAAGGATGTGGTCTCGAGACCACATCCTTAATGATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015716.3-3321s21c1
Sequence:GTACCGGGGAACAAACTGCGGGTGTATTCTCGAGAATACACCCGCAGTTTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015716.3-2928s21c1
Sequence:GTACCGGAGAGCTCGTTCACGATGTTTGCTCGAGCAAACATCGTGAACGAGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015716.3-3460s21c1
Sequence:CCGGGCGGATTAAGTTCCTGGTCATCTCGAGATGACCAGGAACTTAATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015716.3-4231s21c1
Sequence:CCGGCCCTGATGCTTTCGTGATCACCTCGAGGTGATCACGAAAGCATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015716.3-1042s21c1
Sequence:CCGGGCTACTGAAGTTTCCCTTCATCTCGAGATGAAGGGAAACTTCAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015716.3-575s21c1
Sequence:CCGGGAGGACTGTATCGCCTATATCCTCGAGGATATAGGCGATACAGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015716.3-3609s21c1
Sequence:CCGGAGCGGCTCAAGGTCATCTATGCTCGAGCATAGATGACCTTGAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015716
VALIDATED
MINK1 MISSION shRNA Lentiviral Transduction Particles
misshapen-like kinase 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015716.2-2483s1c1
Sequence:CCGGGCAGACTTTGTGTTGCTGAAACTCGAGTTTCAGCAACACAAAGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_015716.2-3118s1c1
Sequence:CCGGCCGGAAGTACAAGAAGCGATTCTCGAGAATCGCTTCTTGTACTTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015716.2-1042s1c1
Sequence:CCGGGCTACTGAAGTTTCCCTTCATCTCGAGATGAAGGGAAACTTCAGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015716.2-3460s1c1
Sequence:CCGGGCGGATTAAGTTCCTGGTCATCTCGAGATGACCAGGAACTTAATCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_015716.2-4334s1c1
Sequence:CCGGCCCAGGAATTGAGTGGGCCTACTCGAGTAGGCCCACTCAATTCCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015716.2-4231s1c1
Sequence:CCGGCCCTGATGCTTTCGTGATCACCTCGAGGTGATCACGAAAGCATCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015716.2-4239s1c1
Sequence:CCGGCTTTCGTGATCACGTGACCATCTCGAGATGGTCACGTGATCACGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015716.2-4057s1c1
Sequence:CCGGGAACCGTAACTGCATCATGAACTCGAGTTCATGATGCAGTTACGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015716.2-3808s1c1
Sequence:CCGGGCGCATCATTAAGGATGTGGTCTCGAGACCACATCCTTAATGATGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015716.3-3321s21c1
Sequence:GTACCGGGGAACAAACTGCGGGTGTATTCTCGAGAATACACCCGCAGTTTGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015716.3-2928s21c1
Sequence:GTACCGGAGAGCTCGTTCACGATGTTTGCTCGAGCAAACATCGTGAACGAGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015716.3-3460s21c1
Sequence:CCGGGCGGATTAAGTTCCTGGTCATCTCGAGATGACCAGGAACTTAATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015716.3-4231s21c1
Sequence:CCGGCCCTGATGCTTTCGTGATCACCTCGAGGTGATCACGAAAGCATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015716.3-1042s21c1
Sequence:CCGGGCTACTGAAGTTTCCCTTCATCTCGAGATGAAGGGAAACTTCAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015716.3-575s21c1
Sequence:CCGGGAGGACTGTATCGCCTATATCCTCGAGGATATAGGCGATACAGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015716.3-3609s21c1
Sequence:CCGGAGCGGCTCAAGGTCATCTATGCTCGAGCATAGATGACCTTGAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016713
VALIDATED
MINK1 MISSION shRNA Bacterial Glycerol Stock
misshapen-like kinase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016713.1-925s1c1
Sequence:CCGGCCCAGGCTCAAGTCAAAGAAACTCGAGTTTCTTTGACTTGAGCCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016713.1-516s1c1
Sequence:CCGGCGACCTGGTAAAGAACACAAACTCGAGTTTGTGTTCTTTACCAGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016713.1-3454s1c1
Sequence:CCGGCGGATTAAGTTCCTGGTCATTCTCGAGAATGACCAGGAACTTAATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016713.1-408s1c1
Sequence:CCGGCCATCGCAATATTGCCACCTACTCGAGTAGGTGGCAATATTGCGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016713.1-2775s1c1
Sequence:CCGGGCTTGCTGATAGCAATGGCTACTCGAGTAGCCATTGCTATCAGCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016713.2-4219s21c1
Sequence:CCGGGCTGGGAACGTGACCTCATATCTCGAGATATGAGGTCACGTTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016713.2-3328s21c1
Sequence:CCGGAGGAACAAACTGCGGGTATATCTCGAGATATACCCGCAGTTTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016713.2-3456s21c1
Sequence:CCGGTGTGAAATATGAACGGATTAACTCGAGTTAATCCGTTCATATTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016713.2-1025s21c1
Sequence:CCGGCCACCGAACAGTTACTCAAATCTCGAGATTTGAGTAACTGTTCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016713
VALIDATED
MINK1 MISSION shRNA shRNA Plasmid DNA
misshapen-like kinase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016713.1-925s1c1
Sequence:CCGGCCCAGGCTCAAGTCAAAGAAACTCGAGTTTCTTTGACTTGAGCCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016713.1-516s1c1
Sequence:CCGGCGACCTGGTAAAGAACACAAACTCGAGTTTGTGTTCTTTACCAGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016713.1-3454s1c1
Sequence:CCGGCGGATTAAGTTCCTGGTCATTCTCGAGAATGACCAGGAACTTAATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016713.1-408s1c1
Sequence:CCGGCCATCGCAATATTGCCACCTACTCGAGTAGGTGGCAATATTGCGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016713.1-2775s1c1
Sequence:CCGGGCTTGCTGATAGCAATGGCTACTCGAGTAGCCATTGCTATCAGCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016713.2-4219s21c1
Sequence:CCGGGCTGGGAACGTGACCTCATATCTCGAGATATGAGGTCACGTTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016713.2-3328s21c1
Sequence:CCGGAGGAACAAACTGCGGGTATATCTCGAGATATACCCGCAGTTTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016713.2-3456s21c1
Sequence:CCGGTGTGAAATATGAACGGATTAACTCGAGTTAATCCGTTCATATTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016713.2-1025s21c1
Sequence:CCGGCCACCGAACAGTTACTCAAATCTCGAGATTTGAGTAACTGTTCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016713
VALIDATED
MINK1 MISSION shRNA Lentiviral Transduction Particles
misshapen-like kinase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016713.1-925s1c1
Sequence:CCGGCCCAGGCTCAAGTCAAAGAAACTCGAGTTTCTTTGACTTGAGCCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016713.1-516s1c1
Sequence:CCGGCGACCTGGTAAAGAACACAAACTCGAGTTTGTGTTCTTTACCAGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016713.1-3454s1c1
Sequence:CCGGCGGATTAAGTTCCTGGTCATTCTCGAGAATGACCAGGAACTTAATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016713.1-408s1c1
Sequence:CCGGCCATCGCAATATTGCCACCTACTCGAGTAGGTGGCAATATTGCGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016713.1-2775s1c1
Sequence:CCGGGCTTGCTGATAGCAATGGCTACTCGAGTAGCCATTGCTATCAGCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016713.2-4219s21c1
Sequence:CCGGGCTGGGAACGTGACCTCATATCTCGAGATATGAGGTCACGTTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016713.2-3328s21c1
Sequence:CCGGAGGAACAAACTGCGGGTATATCTCGAGATATACCCGCAGTTTGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016713.2-3456s21c1
Sequence:CCGGTGTGAAATATGAACGGATTAACTCGAGTTAATCCGTTCATATTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016713.2-1025s21c1
Sequence:CCGGCCACCGAACAGTTACTCAAATCTCGAGATTTGAGTAACTGTTCGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)