EMAIL THIS PAGE TO A FRIEND

MINOS1

mitochondrial inner membrane organizing system 1

110 Gene Product Result for
Synonyms: C1orf151 MIO10
UniProtKB ID: Q5TGZ0, Q96G68
Gene ID:
Mouse(433771) mitochondrial inner membrane organizing system 1
Rat(362641) mitochondrial inner membrane organizing system 1
naked mole-rat(101707836) mitochondrial inner membrane organizing system 1
domestic guinea pig(100723549) mitochondrial inner membrane organizing system 1
sheep(101108634) mitochondrial inner membrane organizing system 1
Zebrafish(751699) mitochondrial inner membrane organizing system 1
chicken(419474) mitochondrial inner membrane organizing system 1
cow(508331) mitochondrial inner membrane organizing system 1
domestic cat(101090276) mitochondrial inner membrane organizing system 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163006 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163006 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163006 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001032363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001032363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001032363 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU166141 MISSION® esiRNA esiRNA targeting mouse 2310028O11Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032363 Rosetta Predictions human pricing
XM_001071412 Rosetta Predictions rat pricing
XM_342957 Rosetta Predictions rat pricing
XM_901483 Rosetta Predictions mouse pricing
XM_924570 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307895 predicted 505
2 SASI_Hs01_00118938 predicted 644
3 SASI_Hs01_00118939 predicted 534
4 SASI_Hs01_00118941 predicted 491
5 SASI_Hs01_00118944 predicted 709
6 SASI_Hs02_00307896 predicted 779
7 SASI_Hs01_00118945 predicted 395
8 SASI_Hs02_00307897 predicted 389
9 SASI_Hs02_00307898 predicted 227
10 SASI_Hs02_00307899 predicted 709
11 SASI_Hs01_00118936 predicted 343
12 SASI_Hs01_00118937 predicted 497
13 SASI_Hs01_00118940 predicted 353
14 SASI_Hs01_00118942 predicted 380
15 SASI_Hs01_00118943 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071412 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335060 predicted 221
2 SASI_Rn02_00335061 predicted 222
3 SASI_Rn02_00335062 predicted 304
4 SASI_Rn02_00335063 predicted 202
5 SASI_Rn02_00335064 predicted 344
6 SASI_Rn02_00335065 predicted 205
7 SASI_Rn02_00335066 predicted 290
8 SASI_Rn02_00335067 predicted 203
9 SASI_Rn02_00335068 predicted 211
10 SASI_Rn02_00335069 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154165 predicted 224
2 SASI_Rn01_00154167 predicted 225
3 SASI_Rn01_00154168 predicted 309
4 SASI_Rn02_00395131 predicted 202
5 SASI_Rn01_00154169 predicted 350
6 SASI_Rn01_00154170 predicted 205
7 SASI_Rn01_00154171 predicted 285
8 SASI_Rn01_00154172 predicted 205
9 SASI_Rn01_00154173 predicted 211
10 SASI_Rn02_00395132 predicted 348
11 SASI_Rn01_00154164 predicted 227
12 SASI_Rn01_00154166 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901483 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246495 predicted 431
2 SASI_Mm01_00246496 predicted 594
3 SASI_Mm01_00246497 predicted 555
4 SASI_Mm01_00246499 predicted 772
5 SASI_Mm02_00430173 predicted 342
6 SASI_Mm01_00246500 predicted 433
7 SASI_Mm01_00246502 predicted 557
8 SASI_Mm01_00246503 predicted 343
9 SASI_Mm01_00246504 predicted 584
10 SASI_Mm02_00430174 predicted 271
11 SASI_Mm01_00246498 predicted 245
12 SASI_Mm01_00246501 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_924570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444199 predicted 432
2 SASI_Mm02_00444200 predicted 597
3 SASI_Mm02_00444201 predicted 557
4 SASI_Mm02_00444202 predicted 774
5 SASI_Mm02_00444203 predicted 333
6 SASI_Mm02_00444204 predicted 442
7 SASI_Mm02_00444205 predicted 559
8 SASI_Mm02_00444206 predicted 337
9 SASI_Mm02_00444207 predicted 590
10 SASI_Mm02_00444208 predicted 278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163006
VALIDATED
MINOS1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial inner membrane organizing system 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163006.1-250s21c1
Sequence:CCGGTTTGGTTCTGGCGTGGGATTGCTCGAGCAATCCCACGCCAGAACCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163006.1-178s21c1
Sequence:CCGGCTAGGTACTGGGTTTGGATTACTCGAGTAATCCAAACCCAGTACCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347129    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163006.1-521s21c1
Sequence:CCGGGAAATTGTAAGGAGGTCTTAACTCGAGTTAAGACCTCCTTACAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163006.1-227s21c1
Sequence:CCGGAGAGAAGAATGTGGCCATTAGCTCGAGCTAATGGCCACATTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163006.1-296s21c1
Sequence:CCGGATGACTTTCAGGCTCCGTATCCTCGAGGATACGGAGCCTGAAAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163006
VALIDATED
MINOS1 MISSION shRNA shRNA Plasmid DNA
mitochondrial inner membrane organizing system 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163006.1-250s21c1
Sequence:CCGGTTTGGTTCTGGCGTGGGATTGCTCGAGCAATCCCACGCCAGAACCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163006.1-178s21c1
Sequence:CCGGCTAGGTACTGGGTTTGGATTACTCGAGTAATCCAAACCCAGTACCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347129    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163006.1-521s21c1
Sequence:CCGGGAAATTGTAAGGAGGTCTTAACTCGAGTTAAGACCTCCTTACAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163006.1-227s21c1
Sequence:CCGGAGAGAAGAATGTGGCCATTAGCTCGAGCTAATGGCCACATTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163006.1-296s21c1
Sequence:CCGGATGACTTTCAGGCTCCGTATCCTCGAGGATACGGAGCCTGAAAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163006
VALIDATED
MINOS1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial inner membrane organizing system 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163006.1-250s21c1
Sequence:CCGGTTTGGTTCTGGCGTGGGATTGCTCGAGCAATCCCACGCCAGAACCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163006.1-178s21c1
Sequence:CCGGCTAGGTACTGGGTTTGGATTACTCGAGTAATCCAAACCCAGTACCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347129    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163006.1-521s21c1
Sequence:CCGGGAAATTGTAAGGAGGTCTTAACTCGAGTTAAGACCTCCTTACAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163006.1-227s21c1
Sequence:CCGGAGAGAAGAATGTGGCCATTAGCTCGAGCTAATGGCCACATTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163006.1-296s21c1
Sequence:CCGGATGACTTTCAGGCTCCGTATCCTCGAGGATACGGAGCCTGAAAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001032363
VALIDATED
MINOS1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial inner membrane organizing system 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-332s1c1
Sequence:CCGGCGGGAGGACAAGAGAAATCATCTCGAGATGATTTCTCTTGTCCTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032363.1-216s1c1
Sequence:CCGGGCATGGGATTAGGAATGGCTTCTCGAGAAGCCATTCCTAATCCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-222s1c1
Sequence:CCGGGATTAGGAATGGCTTATTCCACTCGAGTGGAATAAGCCATTCCTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160436    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001032363.1-718s1c1
Sequence:CCGGCGTAATCAGAAGTTGAAGATTCTCGAGAATCTTCAACTTCTGATTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-264s1c1
Sequence:CCGGCTCCATATCTTCTACATGGAACTCGAGTTCCATGTAGAAGATATGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-390s1c1
Sequence:CCGGGCTGCCATTCTTCTGTAACAACTCGAGTTGTTACAGAAGAATGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-260s1c1
Sequence:CCGGCAGGCTCCATATCTTCTACATCTCGAGATGTAGAAGATATGGAGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-233s1c1
Sequence:CCGGGCTTATTCCAACTGTCAGCATCTCGAGATGCTGACAGTTGGAATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-127s1c1
Sequence:CCGGCGTGAAGATAGGTACTGGTTTCTCGAGAAACCAGTACCTATCTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001032363
VALIDATED
MINOS1 MISSION shRNA shRNA Plasmid DNA
mitochondrial inner membrane organizing system 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-332s1c1
Sequence:CCGGCGGGAGGACAAGAGAAATCATCTCGAGATGATTTCTCTTGTCCTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032363.1-216s1c1
Sequence:CCGGGCATGGGATTAGGAATGGCTTCTCGAGAAGCCATTCCTAATCCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-222s1c1
Sequence:CCGGGATTAGGAATGGCTTATTCCACTCGAGTGGAATAAGCCATTCCTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160436    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001032363.1-718s1c1
Sequence:CCGGCGTAATCAGAAGTTGAAGATTCTCGAGAATCTTCAACTTCTGATTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-264s1c1
Sequence:CCGGCTCCATATCTTCTACATGGAACTCGAGTTCCATGTAGAAGATATGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-390s1c1
Sequence:CCGGGCTGCCATTCTTCTGTAACAACTCGAGTTGTTACAGAAGAATGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-260s1c1
Sequence:CCGGCAGGCTCCATATCTTCTACATCTCGAGATGTAGAAGATATGGAGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-233s1c1
Sequence:CCGGGCTTATTCCAACTGTCAGCATCTCGAGATGCTGACAGTTGGAATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-127s1c1
Sequence:CCGGCGTGAAGATAGGTACTGGTTTCTCGAGAAACCAGTACCTATCTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001032363
VALIDATED
MINOS1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial inner membrane organizing system 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-332s1c1
Sequence:CCGGCGGGAGGACAAGAGAAATCATCTCGAGATGATTTCTCTTGTCCTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032363.1-216s1c1
Sequence:CCGGGCATGGGATTAGGAATGGCTTCTCGAGAAGCCATTCCTAATCCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-222s1c1
Sequence:CCGGGATTAGGAATGGCTTATTCCACTCGAGTGGAATAAGCCATTCCTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160436    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001032363.1-718s1c1
Sequence:CCGGCGTAATCAGAAGTTGAAGATTCTCGAGAATCTTCAACTTCTGATTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-264s1c1
Sequence:CCGGCTCCATATCTTCTACATGGAACTCGAGTTCCATGTAGAAGATATGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-390s1c1
Sequence:CCGGGCTGCCATTCTTCTGTAACAACTCGAGTTGTTACAGAAGAATGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-260s1c1
Sequence:CCGGCAGGCTCCATATCTTCTACATCTCGAGATGTAGAAGATATGGAGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-233s1c1
Sequence:CCGGGCTTATTCCAACTGTCAGCATCTCGAGATGCTGACAGTTGGAATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001032363.1-127s1c1
Sequence:CCGGCGTGAAGATAGGTACTGGTTTCTCGAGAAACCAGTACCTATCTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)