EMAIL THIS PAGE TO A FRIEND

MINPP1

multiple inositol-polyphosphate phosphatase 1

74 Gene Product Result for
Synonyms: HIPER1 MINPP2 MIPP
UniProtKB ID: Q9UNW1, F5H683, O95172, O95286, Q59EJ2, Q9UGA3
Gene ID:
Human(9562) Summary: This gene encodes multiple inositol polyphosphate phosphatase; an enzyme that removes 3-phosphate from inositol phosphate substrates. It is the only enzyme known to hydrolzye inositol pentakisphosphate and inositol hexakisphosphate. This enzyme also converts 2,3 bisphosphoglycerate (2,3-BPG) to 2-phosphoglycerate; an activity formerly thought to be exclusive to 2,3-BPG synthase/2-phosphatase (BPGM) in the Rapoport-Luebering shunt of the glycolytic pathway.[provided by RefSeq, Sep 2009]
Mouse(17330) multiple inositol polyphosphate histidine phosphatase 1
Rat(29688) multiple inositol-polyphosphate phosphatase 1
chicken(395356) multiple inositol-polyphosphate phosphatase 1
cow(541067) multiple inositol-polyphosphate phosphatase 1
Horse(100062448) multiple inositol-polyphosphate phosphatase 1
dog(486462) multiple inositol-polyphosphate phosphatase 1
domestic cat(101091150) multiple inositol-polyphosphate phosphatase 1
sheep(101118833) multiple inositol-polyphosphate phosphatase 1
naked mole-rat(101711589) multiple inositol-polyphosphate phosphatase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004897 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004897 siRNAs that have been validated in the lab human pricing
NM_019263 Rosetta Predictions rat pricing
NM_010799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004897 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126664 validated 1963
2 SASI_Hs01_00126665 predicted 1419
3 SASI_Hs01_00126666 predicted 1984
4 SASI_Hs02_00338543 predicted 1419
5 SASI_Hs01_00126667 predicted 1772
6 SASI_Hs01_00126668 predicted 1953
7 SASI_Hs02_00338544 predicted 1774
8 SASI_Hs01_00126670 predicted 1515
9 SASI_Hs01_00126672 predicted 1504
10 SASI_Hs01_00126673 predicted 1660
11 SASI_Hs01_00126669 predicted 1246
12 SASI_Hs01_00126671 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019263 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262146 predicted 640
2 SASI_Rn02_00262147 predicted 846
3 SASI_Rn02_00262148 predicted 1385
4 SASI_Rn02_00262149 predicted 905
5 SASI_Rn02_00262150 predicted 1208
6 SASI_Rn02_00262151 predicted 1210
7 SASI_Rn02_00262152 predicted 809
8 SASI_Rn02_00262153 predicted 1301
9 SASI_Rn02_00262154 predicted 968
10 SASI_Rn02_00262155 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200640 predicted 1015
2 SASI_Mm01_00200641 predicted 987
3 SASI_Mm01_00200642 predicted 840
4 SASI_Mm01_00200643 predicted 918
5 SASI_Mm01_00200644 predicted 1069
6 SASI_Mm01_00200645 predicted 971
7 SASI_Mm01_00200646 predicted 809
8 SASI_Mm01_00200647 predicted 1328
9 SASI_Mm01_00200648 predicted 1160
10 SASI_Mm01_00200649 predicted 1347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010799
VALIDATED
MINPP1 MISSION shRNA Bacterial Glycerol Stock
multiple inositol-polyphosphate phosphatase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_010799.1-2253s1c1
Sequence:CCGGCGCTGTCAATAATTGTCTTTACTCGAGTAAAGACAATTATTGACAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010799.1-962s1c1
Sequence:CCGGCAAGTGCCAATGAACAGTTTACTCGAGTAAACTGTTCATTGGCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_010799.1-1164s1c1
Sequence:CCGGGCAACCTATTTCAGGACATTTCTCGAGAAATGTCCTGAAATAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_010799.2-1128s1c1
Sequence:CCGGGAAGCTATGGCTACACCATTACTCGAGTAATGGTGTAGCCATAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010799.2-1941s21c1
Sequence:CCGGTACTGACGTAGAACGGTATTACTCGAGTAATACCGTTCTACGTCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010799.2-1019s21c1
Sequence:CCGGTCATTTGACCTGGCAATTAAACTCGAGTTTAATTGCCAGGTCAAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010799.2-921s21c1
Sequence:CCGGCAGAAATGCAGAAGGTCTTAACTCGAGTTAAGACCTTCTGCATTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010799.2-800s21c1
Sequence:CCGGTGTGGCCCTCCAAGAATTAATCTCGAGATTAATTCTTGGAGGGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010799.2-1367s21c1
Sequence:CCGGAGTGGTCACATCGTACCTTATCTCGAGATAAGGTACGATGTGACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010799
VALIDATED
MINPP1 MISSION shRNA shRNA Plasmid DNA
multiple inositol-polyphosphate phosphatase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_010799.1-2253s1c1
Sequence:CCGGCGCTGTCAATAATTGTCTTTACTCGAGTAAAGACAATTATTGACAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010799.1-962s1c1
Sequence:CCGGCAAGTGCCAATGAACAGTTTACTCGAGTAAACTGTTCATTGGCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_010799.1-1164s1c1
Sequence:CCGGGCAACCTATTTCAGGACATTTCTCGAGAAATGTCCTGAAATAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_010799.2-1128s1c1
Sequence:CCGGGAAGCTATGGCTACACCATTACTCGAGTAATGGTGTAGCCATAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010799.2-1941s21c1
Sequence:CCGGTACTGACGTAGAACGGTATTACTCGAGTAATACCGTTCTACGTCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010799.2-1019s21c1
Sequence:CCGGTCATTTGACCTGGCAATTAAACTCGAGTTTAATTGCCAGGTCAAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010799.2-921s21c1
Sequence:CCGGCAGAAATGCAGAAGGTCTTAACTCGAGTTAAGACCTTCTGCATTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010799.2-800s21c1
Sequence:CCGGTGTGGCCCTCCAAGAATTAATCTCGAGATTAATTCTTGGAGGGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010799.2-1367s21c1
Sequence:CCGGAGTGGTCACATCGTACCTTATCTCGAGATAAGGTACGATGTGACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010799
VALIDATED
MINPP1 MISSION shRNA Lentiviral Transduction Particles
multiple inositol-polyphosphate phosphatase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_010799.1-2253s1c1
Sequence:CCGGCGCTGTCAATAATTGTCTTTACTCGAGTAAAGACAATTATTGACAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010799.1-962s1c1
Sequence:CCGGCAAGTGCCAATGAACAGTTTACTCGAGTAAACTGTTCATTGGCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_010799.1-1164s1c1
Sequence:CCGGGCAACCTATTTCAGGACATTTCTCGAGAAATGTCCTGAAATAGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_010799.2-1128s1c1
Sequence:CCGGGAAGCTATGGCTACACCATTACTCGAGTAATGGTGTAGCCATAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010799.2-1941s21c1
Sequence:CCGGTACTGACGTAGAACGGTATTACTCGAGTAATACCGTTCTACGTCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010799.2-1019s21c1
Sequence:CCGGTCATTTGACCTGGCAATTAAACTCGAGTTTAATTGCCAGGTCAAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010799.2-921s21c1
Sequence:CCGGCAGAAATGCAGAAGGTCTTAACTCGAGTTAAGACCTTCTGCATTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010799.2-800s21c1
Sequence:CCGGTGTGGCCCTCCAAGAATTAATCTCGAGATTAATTCTTGGAGGGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010799.2-1367s21c1
Sequence:CCGGAGTGGTCACATCGTACCTTATCTCGAGATAAGGTACGATGTGACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004897
VALIDATED
MINPP1 MISSION shRNA Bacterial Glycerol Stock
multiple inositol-polyphosphate phosphatase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004897.2-880s1c1
Sequence:CCGGCCTGTTCATTTGACCTGGCAACTCGAGTTGCCAGGTCAAATGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004897.2-784s1c1
Sequence:CCGGGACCAGAAATGCAGAACATTTCTCGAGAAATGTTCTGCATTTCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004897.2-1350s1c1
Sequence:CCGGCCTTTGGCTTACTCACAAGAACTCGAGTTCTTGTGAGTAAGCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004897.2-672s1c1
Sequence:CCGGCCTCCAACAGTTAATGATAAACTCGAGTTTATCATTAACTGTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004897.3-1967s21c1
Sequence:GTACCGGGCTTGTAATAGGTAGGCAATTCTCGAGAATTGCCTACCTATTACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004897.3-1746s21c1
Sequence:CCGGCCGAGTGCAGATGTTATTAAACTCGAGTTTAATAACATCTGCACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004897.3-1780s21c1
Sequence:CCGGCCTTTGGCTTACTCACAAGAACTCGAGTTCTTGTGAGTAAGCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004897.3-1102s21c1
Sequence:CCGGCCTCCAACAGTTAATGATAAACTCGAGTTTATCATTAACTGTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004897.3-1214s21c1
Sequence:CCGGGACCAGAAATGCAGAACATTTCTCGAGAAATGTTCTGCATTTCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004897.3-2339s21c1
Sequence:GTACCGGGGTAGGACAGCTCTAGCATTTCTCGAGAAATGCTAGAGCTGTCCTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004897
VALIDATED
MINPP1 MISSION shRNA shRNA Plasmid DNA
multiple inositol-polyphosphate phosphatase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004897.2-880s1c1
Sequence:CCGGCCTGTTCATTTGACCTGGCAACTCGAGTTGCCAGGTCAAATGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004897.2-784s1c1
Sequence:CCGGGACCAGAAATGCAGAACATTTCTCGAGAAATGTTCTGCATTTCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004897.2-1350s1c1
Sequence:CCGGCCTTTGGCTTACTCACAAGAACTCGAGTTCTTGTGAGTAAGCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004897.2-672s1c1
Sequence:CCGGCCTCCAACAGTTAATGATAAACTCGAGTTTATCATTAACTGTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004897.3-1967s21c1
Sequence:GTACCGGGCTTGTAATAGGTAGGCAATTCTCGAGAATTGCCTACCTATTACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004897.3-1746s21c1
Sequence:CCGGCCGAGTGCAGATGTTATTAAACTCGAGTTTAATAACATCTGCACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004897.3-1780s21c1
Sequence:CCGGCCTTTGGCTTACTCACAAGAACTCGAGTTCTTGTGAGTAAGCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004897.3-1102s21c1
Sequence:CCGGCCTCCAACAGTTAATGATAAACTCGAGTTTATCATTAACTGTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004897.3-1214s21c1
Sequence:CCGGGACCAGAAATGCAGAACATTTCTCGAGAAATGTTCTGCATTTCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004897.3-2339s21c1
Sequence:GTACCGGGGTAGGACAGCTCTAGCATTTCTCGAGAAATGCTAGAGCTGTCCTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004897
VALIDATED
MINPP1 MISSION shRNA Lentiviral Transduction Particles
multiple inositol-polyphosphate phosphatase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004897.2-880s1c1
Sequence:CCGGCCTGTTCATTTGACCTGGCAACTCGAGTTGCCAGGTCAAATGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004897.2-784s1c1
Sequence:CCGGGACCAGAAATGCAGAACATTTCTCGAGAAATGTTCTGCATTTCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004897.2-1350s1c1
Sequence:CCGGCCTTTGGCTTACTCACAAGAACTCGAGTTCTTGTGAGTAAGCCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004897.2-672s1c1
Sequence:CCGGCCTCCAACAGTTAATGATAAACTCGAGTTTATCATTAACTGTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004897.3-1967s21c1
Sequence:GTACCGGGCTTGTAATAGGTAGGCAATTCTCGAGAATTGCCTACCTATTACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004897.3-1746s21c1
Sequence:CCGGCCGAGTGCAGATGTTATTAAACTCGAGTTTAATAACATCTGCACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004897.3-1780s21c1
Sequence:CCGGCCTTTGGCTTACTCACAAGAACTCGAGTTCTTGTGAGTAAGCCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004897.3-1102s21c1
Sequence:CCGGCCTCCAACAGTTAATGATAAACTCGAGTTTATCATTAACTGTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004897.3-1214s21c1
Sequence:CCGGGACCAGAAATGCAGAACATTTCTCGAGAAATGTTCTGCATTTCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004897.3-2339s21c1
Sequence:GTACCGGGGTAGGACAGCTCTAGCATTTCTCGAGAAATGCTAGAGCTGTCCTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)