EMAIL THIS PAGE TO A FRIEND

MIOS

missing oocyte, meiosis regulator, homolog (Drosophila)

98 Gene Product Result for
UniProtKB ID: Q9NXC5, B2RTV6, O75216, Q7L551, Q9H092
Gene ID:
Mouse(252875) missing oocyte, meiosis regulator, homolog (Drosophila)
Rat(362324) missing oocyte, meiosis regulator, homolog (Drosophila)
Zebrafish(393208) missing oocyte, meiosis regulator, homolog (Drosophila)
dog(482316) missing oocyte, meiosis regulator, homolog (Drosophila)
domestic cat(101096967) missing oocyte, meiosis regulator, homolog (Drosophila)
Horse(100052380) missing oocyte, meiosis regulator, homolog (Drosophila)
cow(512321) missing oocyte, meiosis regulator, homolog (Drosophila)
chicken(420577) missing oocyte, meiosis regulator, homolog (Drosophila)
sheep(101120823) missing oocyte, meiosis regulator, homolog (Drosophila)
naked mole-rat(101705742) missing oocyte, meiosis regulator, homolog (Drosophila)
Domestic Rabbit(100358528) missing oocyte, meiosis regulator, homolog (Drosophila)
domestic guinea pig(100714787) missing oocyte, meiosis regulator, homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145374 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145374 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145374 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019005 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019005 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019005 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019005 Rosetta Predictions human pricing
XM_001055421 Rosetta Predictions rat pricing
XM_342642 Rosetta Predictions rat pricing
NM_145374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122528 predicted 730
2 SASI_Hs01_00122529 predicted 2430
3 SASI_Hs01_00122530 predicted 1570
4 SASI_Hs02_00352528 predicted 1492
5 SASI_Hs01_00122532 predicted 2288
6 SASI_Hs02_00352529 predicted 2753
7 SASI_Hs02_00352530 predicted 2330
8 SASI_Hs01_00122533 predicted 2284
9 SASI_Hs01_00122535 predicted 2268
10 SASI_Hs01_00122536 predicted 1321
11 SASI_Hs01_00122531 predicted 386
12 SASI_Hs01_00122534 predicted 1714
13 SASI_Hs01_00122537 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279456 predicted 1545
2 SASI_Rn02_00279457 predicted 716
3 SASI_Rn02_00279458 predicted 1574
4 SASI_Rn02_00279459 predicted 2303
5 SASI_Rn02_00279460 predicted 1134
6 SASI_Rn02_00279461 predicted 2784
7 SASI_Rn02_00279462 predicted 824
8 SASI_Rn02_00279463 predicted 1019
9 SASI_Rn02_00279464 predicted 1091
10 SASI_Rn02_00279465 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394590 predicted 1549
2 SASI_Rn02_00394591 predicted 717
3 SASI_Rn02_00394592 predicted 1574
4 SASI_Rn02_00394593 predicted 2306
5 SASI_Rn02_00394594 predicted 1136
6 SASI_Rn02_00394595 predicted 2783
7 SASI_Rn02_00394596 predicted 820
8 SASI_Rn02_00394597 predicted 1022
9 SASI_Rn02_00394598 predicted 1096
10 SASI_Rn02_00394599 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172519 predicted 1548
2 SASI_Mm01_00172520 predicted 1564
3 SASI_Mm02_00340661 predicted 2463
4 SASI_Mm01_00172521 predicted 714
5 SASI_Mm01_00172523 predicted 1126
6 SASI_Mm02_00340662 predicted 2531
7 SASI_Mm01_00172525 predicted 2077
8 SASI_Mm01_00172526 predicted 887
9 SASI_Mm01_00172527 predicted 1005
10 SASI_Mm01_00172528 predicted 344
11 SASI_Mm01_00172522 predicted 1476
12 SASI_Mm01_00172524 predicted 1076
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145374
MIOS MISSION shRNA Bacterial Glycerol Stock
missing oocyte, meiosis regulator, homolog (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145374.2-555s21c1
Sequence:CCGGAGTCTTGGTCAAGATCATAACCTCGAGGTTATGATCTTGACCAAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145374.2-2835s21c1
Sequence:CCGGGTATCTGCATGCACGTGTAAACTCGAGTTTACACGTGCATGCAGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145374.2-401s21c1
Sequence:CCGGAGCTGGATCGTTACGTTTATCCTCGAGGATAAACGTAACGATCCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145374.2-895s21c1
Sequence:CCGGTGCATCGTAATCTAGCAATATCTCGAGATATTGCTAGATTACGATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145374.2-434s21c1
Sequence:CCGGAGCGACATTGCTGTCAATAAACTCGAGTTTATTGACAGCAATGTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145374.1-1124s1c1
Sequence:CCGGGCCTGCTTGCTACTTTAACAACTCGAGTTGTTAAAGTAGCAAGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145374.1-3114s1c1
Sequence:CCGGGCTGTTTAGTAGGTTAAAGTTCTCGAGAACTTTAACCTACTAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145374.1-1709s1c1
Sequence:CCGGGCTTGGATAAACAAACTGATACTCGAGTATCAGTTTGTTTATCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145374.1-2140s1c1
Sequence:CCGGGCTTGTAAATTCCTTGGTGATCTCGAGATCACCAAGGAATTTACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145374
MIOS MISSION shRNA shRNA Plasmid DNA
missing oocyte, meiosis regulator, homolog (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145374.2-555s21c1
Sequence:CCGGAGTCTTGGTCAAGATCATAACCTCGAGGTTATGATCTTGACCAAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145374.2-2835s21c1
Sequence:CCGGGTATCTGCATGCACGTGTAAACTCGAGTTTACACGTGCATGCAGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145374.2-401s21c1
Sequence:CCGGAGCTGGATCGTTACGTTTATCCTCGAGGATAAACGTAACGATCCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145374.2-895s21c1
Sequence:CCGGTGCATCGTAATCTAGCAATATCTCGAGATATTGCTAGATTACGATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145374.2-434s21c1
Sequence:CCGGAGCGACATTGCTGTCAATAAACTCGAGTTTATTGACAGCAATGTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145374.1-1124s1c1
Sequence:CCGGGCCTGCTTGCTACTTTAACAACTCGAGTTGTTAAAGTAGCAAGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145374.1-3114s1c1
Sequence:CCGGGCTGTTTAGTAGGTTAAAGTTCTCGAGAACTTTAACCTACTAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145374.1-1709s1c1
Sequence:CCGGGCTTGGATAAACAAACTGATACTCGAGTATCAGTTTGTTTATCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145374.1-2140s1c1
Sequence:CCGGGCTTGTAAATTCCTTGGTGATCTCGAGATCACCAAGGAATTTACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145374
MIOS MISSION shRNA Lentiviral Transduction Particles
missing oocyte, meiosis regulator, homolog (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145374.2-555s21c1
Sequence:CCGGAGTCTTGGTCAAGATCATAACCTCGAGGTTATGATCTTGACCAAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145374.2-2835s21c1
Sequence:CCGGGTATCTGCATGCACGTGTAAACTCGAGTTTACACGTGCATGCAGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145374.2-401s21c1
Sequence:CCGGAGCTGGATCGTTACGTTTATCCTCGAGGATAAACGTAACGATCCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145374.2-895s21c1
Sequence:CCGGTGCATCGTAATCTAGCAATATCTCGAGATATTGCTAGATTACGATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145374.2-434s21c1
Sequence:CCGGAGCGACATTGCTGTCAATAAACTCGAGTTTATTGACAGCAATGTCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145374.1-1124s1c1
Sequence:CCGGGCCTGCTTGCTACTTTAACAACTCGAGTTGTTAAAGTAGCAAGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145374.1-3114s1c1
Sequence:CCGGGCTGTTTAGTAGGTTAAAGTTCTCGAGAACTTTAACCTACTAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145374.1-1709s1c1
Sequence:CCGGGCTTGGATAAACAAACTGATACTCGAGTATCAGTTTGTTTATCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145374.1-2140s1c1
Sequence:CCGGGCTTGTAAATTCCTTGGTGATCTCGAGATCACCAAGGAATTTACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019005
VALIDATED
MIOS MISSION shRNA Bacterial Glycerol Stock
missing oocyte, meiosis regulator, homolog (Drosophila)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019005.3-2256s21c1
Sequence:CCGGTTGCTTACAGGCCTTACTAAACTCGAGTTTAGTAAGGCCTGTAAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019005.3-456s21c1
Sequence:CCGGGCAGCTACATTACTGTCAATACTCGAGTATTGACAGTAATGTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019005.3-2859s21c1
Sequence:CCGGGTGTCGGCATGCACGTGTAAACTCGAGTTTACACGTGCATGCCGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019005.3-995s21c1
Sequence:CCGGTGTGACGGTAGACCCATATTTCTCGAGAAATATGGGTCTACCGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019005.3-2977s21c1
Sequence:CCGGTCTAGTAGGTGTCCTTCATAGCTCGAGCTATGAAGGACACCTACTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019005.3-425s21c1
Sequence:CCGGAGCTGGATCTTTACGTTTATCCTCGAGGATAAACGTAAAGATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019005.2-2055s1c1
Sequence:CCGGCCCGTATTTGTGTGTCATGTTCTCGAGAACATGACACACAAATACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019005.2-448s1c1
Sequence:CCGGGCAGCTACATTACTGTCAATACTCGAGTATTGACAGTAATGTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019005.2-925s1c1
Sequence:CCGGGCTATATTTGATCTTCGGAATCTCGAGATTCCGAAGATCAAATATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019005.2-334s1c1
Sequence:CCGGCCACACCATGTTGATAGATTTCTCGAGAAATCTATCAACATGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019005.2-2603s1c1
Sequence:CCGGCGAAATCTAAAGTCACAAGTTCTCGAGAACTTGTGACTTTAGATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019005
VALIDATED
MIOS MISSION shRNA shRNA Plasmid DNA
missing oocyte, meiosis regulator, homolog (Drosophila)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019005.3-2256s21c1
Sequence:CCGGTTGCTTACAGGCCTTACTAAACTCGAGTTTAGTAAGGCCTGTAAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019005.3-456s21c1
Sequence:CCGGGCAGCTACATTACTGTCAATACTCGAGTATTGACAGTAATGTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019005.3-2859s21c1
Sequence:CCGGGTGTCGGCATGCACGTGTAAACTCGAGTTTACACGTGCATGCCGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019005.3-995s21c1
Sequence:CCGGTGTGACGGTAGACCCATATTTCTCGAGAAATATGGGTCTACCGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019005.3-2977s21c1
Sequence:CCGGTCTAGTAGGTGTCCTTCATAGCTCGAGCTATGAAGGACACCTACTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019005.3-425s21c1
Sequence:CCGGAGCTGGATCTTTACGTTTATCCTCGAGGATAAACGTAAAGATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019005.2-2055s1c1
Sequence:CCGGCCCGTATTTGTGTGTCATGTTCTCGAGAACATGACACACAAATACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019005.2-448s1c1
Sequence:CCGGGCAGCTACATTACTGTCAATACTCGAGTATTGACAGTAATGTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019005.2-925s1c1
Sequence:CCGGGCTATATTTGATCTTCGGAATCTCGAGATTCCGAAGATCAAATATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019005.2-334s1c1
Sequence:CCGGCCACACCATGTTGATAGATTTCTCGAGAAATCTATCAACATGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019005.2-2603s1c1
Sequence:CCGGCGAAATCTAAAGTCACAAGTTCTCGAGAACTTGTGACTTTAGATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019005
VALIDATED
MIOS MISSION shRNA Lentiviral Transduction Particles
missing oocyte, meiosis regulator, homolog (Drosophila)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019005.3-2256s21c1
Sequence:CCGGTTGCTTACAGGCCTTACTAAACTCGAGTTTAGTAAGGCCTGTAAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019005.3-456s21c1
Sequence:CCGGGCAGCTACATTACTGTCAATACTCGAGTATTGACAGTAATGTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019005.3-2859s21c1
Sequence:CCGGGTGTCGGCATGCACGTGTAAACTCGAGTTTACACGTGCATGCCGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019005.3-995s21c1
Sequence:CCGGTGTGACGGTAGACCCATATTTCTCGAGAAATATGGGTCTACCGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019005.3-2977s21c1
Sequence:CCGGTCTAGTAGGTGTCCTTCATAGCTCGAGCTATGAAGGACACCTACTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019005.3-425s21c1
Sequence:CCGGAGCTGGATCTTTACGTTTATCCTCGAGGATAAACGTAAAGATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019005.2-2055s1c1
Sequence:CCGGCCCGTATTTGTGTGTCATGTTCTCGAGAACATGACACACAAATACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019005.2-448s1c1
Sequence:CCGGGCAGCTACATTACTGTCAATACTCGAGTATTGACAGTAATGTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019005.2-925s1c1
Sequence:CCGGGCTATATTTGATCTTCGGAATCTCGAGATTCCGAAGATCAAATATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019005.2-334s1c1
Sequence:CCGGCCACACCATGTTGATAGATTTCTCGAGAAATCTATCAACATGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019005.2-2603s1c1
Sequence:CCGGCGAAATCTAAAGTCACAAGTTCTCGAGAACTTGTGACTTTAGATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)