EMAIL THIS PAGE TO A FRIEND

MIOX

myo-inositol oxygenase

56 Gene Product Result for
Synonyms: ALDRL6
UniProtKB ID: Q9UGB7, Q05DJ6, Q5S8C9, Q9BZZ1, Q9UHB8
Gene ID:
Mouse(56727) myo-inositol oxygenase
Rat(252899) myo-inositol oxygenase
domestic guinea pig(100719643) myo-inositol oxygenase
naked mole-rat(101700386) myo-inositol oxygenase
sheep(101117241) myo-inositol oxygenase
Zebrafish(571850) myo-inositol oxygenase
cow(508591) myo-inositol oxygenase
domestic cat(101081909) myo-inositol oxygenase
dog(481189) myo-inositol oxygenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017584 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019977 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019977 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019977 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001321 MISSION® esiRNA esiRNA targeting human MIOX (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017584 Rosetta Predictions human pricing
NM_145771 Rosetta Predictions rat pricing
NM_019977 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065440 predicted 1137
2 SASI_Hs01_00065441 predicted 1141
3 SASI_Hs01_00065442 predicted 682
4 SASI_Hs01_00065443 predicted 1107
5 SASI_Hs01_00065444 predicted 624
6 SASI_Hs01_00065445 predicted 259
7 SASI_Hs02_00350249 predicted 710
8 SASI_Hs01_00065446 predicted 743
9 SASI_Hs01_00065447 predicted 249
10 SASI_Hs01_00065448 predicted 1108
11 SASI_Hs01_00065449 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268765 predicted 618
2 SASI_Rn01_00101186 predicted 574
3 SASI_Rn01_00101187 predicted 550
4 SASI_Rn02_00268766 predicted 410
5 SASI_Rn02_00268767 predicted 410
6 SASI_Rn02_00268768 predicted 467
7 SASI_Rn01_00101192 predicted 330
8 SASI_Rn02_00268769 predicted 411
9 SASI_Rn02_00268770 predicted 739
10 SASI_Rn02_00268771 predicted 525
11 SASI_Rn01_00101183 predicted 221
12 SASI_Rn01_00101184 predicted 787
13 SASI_Rn01_00101185 predicted 649
14 SASI_Rn01_00101188 predicted 346
15 SASI_Rn01_00101189 predicted 208
16 SASI_Rn01_00101190 predicted 263
17 SASI_Rn01_00101191 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057923 predicted 225
2 SASI_Mm01_00057924 predicted 665
3 SASI_Mm01_00057925 predicted 372
4 SASI_Mm01_00057927 predicted 214
5 SASI_Mm01_00057928 predicted 212
6 SASI_Mm01_00057929 predicted 606
7 SASI_Mm01_00057930 predicted 562
8 SASI_Mm01_00057931 predicted 282
9 SASI_Mm01_00057932 predicted 543
10 SASI_Mm02_00325284 predicted 354
11 SASI_Mm01_00057926 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017584
MIOX MISSION shRNA Bacterial Glycerol Stock
myo-inositol oxygenase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017584.4-624s1c1
Sequence:CCGGCCAGGTGATGAAGTTTAACAACTCGAGTTGTTAAACTTCATCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017584.4-55s1c1
Sequence:CCGGTCCCTGGTCTACCGACCTGATCTCGAGATCAGGTCGGTAGACCAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017584.4-171s1c1
Sequence:CCGGCACGCACCAGACAGTGGACTTCTCGAGAAGTCCACTGTCTGGTGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017584.4-606s1c1
Sequence:CCGGCCATGATGAGTACATGTACCACTCGAGTGGTACATGTACTCATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017584.4-771s1c1
Sequence:CCGGGTTCAACAAGTTCGACCTCTACTCGAGTAGAGGTCGAACTTGTTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017584.5-1119s21c1
Sequence:CCGGACTTGTGCCTGGCGTCAATAACTCGAGTTATTGACGCCAGGCACAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017584.5-762s21c1
Sequence:CCGCGATCCGGTTCCACTCCTTCTACTCGAGTAGAAGGAGTGGAACCGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017584.5-372s21c1
Sequence:CCGGGTCGGACCCGGACGTAGATTTCTCGAGAAATCTACGTCCGGGTCCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017584
MIOX MISSION shRNA shRNA Plasmid DNA
myo-inositol oxygenase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017584.4-624s1c1
Sequence:CCGGCCAGGTGATGAAGTTTAACAACTCGAGTTGTTAAACTTCATCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017584.4-55s1c1
Sequence:CCGGTCCCTGGTCTACCGACCTGATCTCGAGATCAGGTCGGTAGACCAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017584.4-171s1c1
Sequence:CCGGCACGCACCAGACAGTGGACTTCTCGAGAAGTCCACTGTCTGGTGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017584.4-606s1c1
Sequence:CCGGCCATGATGAGTACATGTACCACTCGAGTGGTACATGTACTCATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017584.4-771s1c1
Sequence:CCGGGTTCAACAAGTTCGACCTCTACTCGAGTAGAGGTCGAACTTGTTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017584.5-1119s21c1
Sequence:CCGGACTTGTGCCTGGCGTCAATAACTCGAGTTATTGACGCCAGGCACAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017584.5-762s21c1
Sequence:CCGCGATCCGGTTCCACTCCTTCTACTCGAGTAGAAGGAGTGGAACCGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017584.5-372s21c1
Sequence:CCGGGTCGGACCCGGACGTAGATTTCTCGAGAAATCTACGTCCGGGTCCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017584
MIOX MISSION shRNA Lentiviral Transduction Particles
myo-inositol oxygenase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017584.4-624s1c1
Sequence:CCGGCCAGGTGATGAAGTTTAACAACTCGAGTTGTTAAACTTCATCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017584.4-55s1c1
Sequence:CCGGTCCCTGGTCTACCGACCTGATCTCGAGATCAGGTCGGTAGACCAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017584.4-171s1c1
Sequence:CCGGCACGCACCAGACAGTGGACTTCTCGAGAAGTCCACTGTCTGGTGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017584.4-606s1c1
Sequence:CCGGCCATGATGAGTACATGTACCACTCGAGTGGTACATGTACTCATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017584.4-771s1c1
Sequence:CCGGGTTCAACAAGTTCGACCTCTACTCGAGTAGAGGTCGAACTTGTTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017584.5-1119s21c1
Sequence:CCGGACTTGTGCCTGGCGTCAATAACTCGAGTTATTGACGCCAGGCACAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017584.5-762s21c1
Sequence:CCGCGATCCGGTTCCACTCCTTCTACTCGAGTAGAAGGAGTGGAACCGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017584.5-372s21c1
Sequence:CCGGGTCGGACCCGGACGTAGATTTCTCGAGAAATCTACGTCCGGGTCCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019977
MIOX MISSION shRNA Bacterial Glycerol Stock
myo-inositol oxygenase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019977.2-150s1c1
Sequence:CCGGCTTTACCACATACAAGCTCATCTCGAGATGAGCTTGTATGTGGTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019977.2-621s1c1
Sequence:CCGGCCTATACCAGATGATGAAGTTCTCGAGAACTTCATCATCTGGTATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019977.2-502s1c1
Sequence:CCGGGACTCTACTTTCCAGGACAATCTCGAGATTGTCCTGGAAAGTAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019977.2-835s1c1
Sequence:CCGGCCCTACTATCAAGGGCTGATTCTCGAGAATCAGCCCTTGATAGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019977.2-919s1c1
Sequence:CCGGCAGTACACCTAGGCTGGACAACTCGAGTTGTCCAGCCTAGGTGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019977.2-288s21c1
Sequence:CCGGATCTGACCCAGACGTAGATTTCTCGAGAAATCTACGTCTGGGTCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019977.2-767s21c1
Sequence:CCGGTGCAAGAGTTCAACAAGTTTGCTCGAGCAAACTTGTTGAACTCTTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019977.2-579s21c1
Sequence:CCGGTGGACTAGAGAACGTCCTTATCTCGAGATAAGGACGTTCTCTAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019977
MIOX MISSION shRNA shRNA Plasmid DNA
myo-inositol oxygenase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019977.2-150s1c1
Sequence:CCGGCTTTACCACATACAAGCTCATCTCGAGATGAGCTTGTATGTGGTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019977.2-621s1c1
Sequence:CCGGCCTATACCAGATGATGAAGTTCTCGAGAACTTCATCATCTGGTATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019977.2-502s1c1
Sequence:CCGGGACTCTACTTTCCAGGACAATCTCGAGATTGTCCTGGAAAGTAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019977.2-835s1c1
Sequence:CCGGCCCTACTATCAAGGGCTGATTCTCGAGAATCAGCCCTTGATAGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019977.2-919s1c1
Sequence:CCGGCAGTACACCTAGGCTGGACAACTCGAGTTGTCCAGCCTAGGTGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019977.2-288s21c1
Sequence:CCGGATCTGACCCAGACGTAGATTTCTCGAGAAATCTACGTCTGGGTCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019977.2-767s21c1
Sequence:CCGGTGCAAGAGTTCAACAAGTTTGCTCGAGCAAACTTGTTGAACTCTTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019977.2-579s21c1
Sequence:CCGGTGGACTAGAGAACGTCCTTATCTCGAGATAAGGACGTTCTCTAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019977
MIOX MISSION shRNA Lentiviral Transduction Particles
myo-inositol oxygenase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019977.2-150s1c1
Sequence:CCGGCTTTACCACATACAAGCTCATCTCGAGATGAGCTTGTATGTGGTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019977.2-621s1c1
Sequence:CCGGCCTATACCAGATGATGAAGTTCTCGAGAACTTCATCATCTGGTATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019977.2-502s1c1
Sequence:CCGGGACTCTACTTTCCAGGACAATCTCGAGATTGTCCTGGAAAGTAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019977.2-835s1c1
Sequence:CCGGCCCTACTATCAAGGGCTGATTCTCGAGAATCAGCCCTTGATAGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019977.2-919s1c1
Sequence:CCGGCAGTACACCTAGGCTGGACAACTCGAGTTGTCCAGCCTAGGTGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019977.2-288s21c1
Sequence:CCGGATCTGACCCAGACGTAGATTTCTCGAGAAATCTACGTCTGGGTCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019977.2-767s21c1
Sequence:CCGGTGCAAGAGTTCAACAAGTTTGCTCGAGCAAACTTGTTGAACTCTTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019977.2-579s21c1
Sequence:CCGGTGGACTAGAGAACGTCCTTATCTCGAGATAAGGACGTTCTCTAGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)