EMAIL THIS PAGE TO A FRIEND

MIPEP

mitochondrial intermediate peptidase

56 Gene Product Result for
Synonyms: HMIP MIP
UniProtKB ID: Q99797, Q5JV15, Q5T9Q9, Q96G65
Gene ID:
Human(4285) Summary: The product of this gene performs the final step in processing a specific class of nuclear-encoded proteins targeted to the mitochondrial matrix or inner membrane. This protein is primarily involved in the maturation of oxidative phosphorylation (OXPHOS)-related proteins. This gene may contribute to the functional effects of frataxin deficiency and the clinical manifestations of Friedreich ataxia. [provided by RefSeq, Jul 2008]
Mouse(70478) mitochondrial intermediate peptidase
Rat(81684) mitochondrial intermediate peptidase
Zebrafish(100005953) mitochondrial intermediate peptidase
dog(477338) mitochondrial intermediate peptidase
Horse(100058095) mitochondrial intermediate peptidase
cow(517531) mitochondrial intermediate peptidase
domestic cat(101084847) mitochondrial intermediate peptidase
chicken(418942) mitochondrial intermediate peptidase
domestic guinea pig(100717132) mitochondrial intermediate peptidase
Domestic Rabbit(100355371) mitochondrial intermediate peptidase
naked mole-rat(101696293) mitochondrial intermediate peptidase
sheep(101116412) mitochondrial intermediate peptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005932 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027436 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027436 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027436 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047811 MISSION® esiRNA esiRNA human MIPEP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005932 Rosetta Predictions human pricing
NM_031052 Rosetta Predictions rat pricing
NM_027436 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201597 predicted 800
2 SASI_Hs01_00201598 predicted 1728
3 SASI_Hs01_00201599 predicted 1189
4 SASI_Hs01_00201600 predicted 1471
5 SASI_Hs01_00201601 predicted 1184
6 SASI_Hs01_00201602 predicted 1077
7 SASI_Hs01_00201603 predicted 915
8 SASI_Hs01_00201604 predicted 1913
9 SASI_Hs02_00340588 predicted 956
10 SASI_Hs01_00201606 predicted 777
11 SASI_Hs01_00201605 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031052 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108296 predicted 1580
2 SASI_Rn01_00108297 predicted 1473
3 SASI_Rn02_00264277 predicted 739
4 SASI_Rn01_00108299 predicted 1957
5 SASI_Rn01_00108300 predicted 1459
6 SASI_Rn01_00108301 predicted 958
7 SASI_Rn01_00108302 predicted 1957
8 SASI_Rn01_00108303 predicted 1164
9 SASI_Rn01_00108304 predicted 1148
10 SASI_Rn01_00108305 predicted 1645
11 SASI_Rn01_00108298 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033367 predicted 660
2 SASI_Mm01_00033368 predicted 611
3 SASI_Mm01_00033369 predicted 1550
4 SASI_Mm01_00033370 predicted 1614
5 SASI_Mm01_00033371 predicted 1686
6 SASI_Mm01_00033372 predicted 1201
7 SASI_Mm01_00033373 predicted 920
8 SASI_Mm01_00033375 predicted 544
9 SASI_Mm01_00033376 predicted 782
10 SASI_Mm02_00332191 predicted 2003
11 SASI_Mm01_00033374 predicted 1738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005932
MIPEP MISSION shRNA Bacterial Glycerol Stock
mitochondrial intermediate peptidase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005932.2-887s21c1
Sequence:CCGGGTGCGAGAAGCTGCTTATAAACTCGAGTTTATAAGCAGCTTCTCGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005932.2-1979s21c1
Sequence:CCGGGGGTATGGTGCTAGATATTACCTCGAGGTAATATCTAGCACCATACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005932.1-750s1c1
Sequence:CCGGCCCAACAAGATTGAGAAGCATCTCGAGATGCTTCTCAATCTTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005932.1-2137s1c1
Sequence:CCGGCTTCTGTTGATGACTTCGTAACTCGAGTTACGAAGTCATCAACAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005932.1-1674s1c1
Sequence:CCGGGCAAATGATTATCGAGTAGTTCTCGAGAACTACTCGATAATCATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005932.1-900s1c1
Sequence:CCGGGCTGGTCAATTGAAATGTTTACTCGAGTAAACATTTCAATTGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005932.1-1861s1c1
Sequence:CCGGCCACAGACATTCTCAAGGAAACTCGAGTTTCCTTGAGAATGTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005932
MIPEP MISSION shRNA shRNA Plasmid DNA
mitochondrial intermediate peptidase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005932.2-887s21c1
Sequence:CCGGGTGCGAGAAGCTGCTTATAAACTCGAGTTTATAAGCAGCTTCTCGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005932.2-1979s21c1
Sequence:CCGGGGGTATGGTGCTAGATATTACCTCGAGGTAATATCTAGCACCATACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005932.1-750s1c1
Sequence:CCGGCCCAACAAGATTGAGAAGCATCTCGAGATGCTTCTCAATCTTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005932.1-2137s1c1
Sequence:CCGGCTTCTGTTGATGACTTCGTAACTCGAGTTACGAAGTCATCAACAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005932.1-1674s1c1
Sequence:CCGGGCAAATGATTATCGAGTAGTTCTCGAGAACTACTCGATAATCATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005932.1-900s1c1
Sequence:CCGGGCTGGTCAATTGAAATGTTTACTCGAGTAAACATTTCAATTGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005932.1-1861s1c1
Sequence:CCGGCCACAGACATTCTCAAGGAAACTCGAGTTTCCTTGAGAATGTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005932
MIPEP MISSION shRNA Lentiviral Transduction Particles
mitochondrial intermediate peptidase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005932.2-887s21c1
Sequence:CCGGGTGCGAGAAGCTGCTTATAAACTCGAGTTTATAAGCAGCTTCTCGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005932.2-1979s21c1
Sequence:CCGGGGGTATGGTGCTAGATATTACCTCGAGGTAATATCTAGCACCATACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005932.1-750s1c1
Sequence:CCGGCCCAACAAGATTGAGAAGCATCTCGAGATGCTTCTCAATCTTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005932.1-2137s1c1
Sequence:CCGGCTTCTGTTGATGACTTCGTAACTCGAGTTACGAAGTCATCAACAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005932.1-1674s1c1
Sequence:CCGGGCAAATGATTATCGAGTAGTTCTCGAGAACTACTCGATAATCATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005932.1-900s1c1
Sequence:CCGGGCTGGTCAATTGAAATGTTTACTCGAGTAAACATTTCAATTGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005932.1-1861s1c1
Sequence:CCGGCCACAGACATTCTCAAGGAAACTCGAGTTTCCTTGAGAATGTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027436
VALIDATED
MIPEP MISSION shRNA Bacterial Glycerol Stock
mitochondrial intermediate peptidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027436.1-1221s1c1
Sequence:CCGGCCCAGTTTATACTGCCCGTTTCTCGAGAAACGGGCAGTATAAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027436.1-648s1c1
Sequence:CCGGGCCGAACTATTTATGTTTGATCTCGAGATCAAACATAAATAGTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027436.1-1534s1c1
Sequence:CCGGCCAGGGATTTCCCTACATTATCTCGAGATAATGTAGGGAAATCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027436.1-1656s1c1
Sequence:CCGGCCTACTGACTTTGCTGAAGTTCTCGAGAACTTCAGCAAAGTCAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027436.1-927s1c1
Sequence:CCGGGCCGATCAGTTGAAATGTTTACTCGAGTAAACATTTCAACTGATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027436
VALIDATED
MIPEP MISSION shRNA shRNA Plasmid DNA
mitochondrial intermediate peptidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027436.1-1221s1c1
Sequence:CCGGCCCAGTTTATACTGCCCGTTTCTCGAGAAACGGGCAGTATAAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027436.1-648s1c1
Sequence:CCGGGCCGAACTATTTATGTTTGATCTCGAGATCAAACATAAATAGTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027436.1-1534s1c1
Sequence:CCGGCCAGGGATTTCCCTACATTATCTCGAGATAATGTAGGGAAATCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027436.1-1656s1c1
Sequence:CCGGCCTACTGACTTTGCTGAAGTTCTCGAGAACTTCAGCAAAGTCAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027436.1-927s1c1
Sequence:CCGGGCCGATCAGTTGAAATGTTTACTCGAGTAAACATTTCAACTGATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027436
VALIDATED
MIPEP MISSION shRNA Lentiviral Transduction Particles
mitochondrial intermediate peptidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027436.1-1221s1c1
Sequence:CCGGCCCAGTTTATACTGCCCGTTTCTCGAGAAACGGGCAGTATAAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027436.1-648s1c1
Sequence:CCGGGCCGAACTATTTATGTTTGATCTCGAGATCAAACATAAATAGTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027436.1-1534s1c1
Sequence:CCGGCCAGGGATTTCCCTACATTATCTCGAGATAATGTAGGGAAATCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027436.1-1656s1c1
Sequence:CCGGCCTACTGACTTTGCTGAAGTTCTCGAGAACTTCAGCAAAGTCAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027436.1-927s1c1
Sequence:CCGGGCCGATCAGTTGAAATGTTTACTCGAGTAAACATTTCAACTGATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)