EMAIL THIS PAGE TO A FRIEND

MIR137HG

MIR137 host gene (non-protein coding)

30 Gene Product Result for
Species: Human MIR137HG(400765)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_375753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375753 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001688 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001688 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001688 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001688 Rosetta Predictions human pricing
XR_017942 Rosetta Predictions human pricing
XR_040284 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040867 predicted 1050
2 SASI_Hs01_00040868 predicted 808
3 SASI_Hs01_00040869 predicted 752
4 SASI_Hs01_00040870 predicted 790
5 SASI_Hs01_00040871 predicted 673
6 SASI_Hs01_00040872 predicted 606
7 SASI_Hs01_00040873 predicted 1025
8 SASI_Hs01_00040874 predicted 591
9 SASI_Hs01_00040875 predicted 932
10 SASI_Hs01_00040876 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494997 predicted 1898
2 SASI_Hs02_00494998 predicted 796
3 SASI_Hs02_00494999 predicted 1448
4 SASI_Hs02_00495000 predicted 1342
5 SASI_Hs02_00495001 predicted 741
6 SASI_Hs02_00495002 predicted 782
7 SASI_Hs02_00495003 predicted 1585
8 SASI_Hs02_00495004 predicted 593
9 SASI_Hs02_00495005 predicted 2071
10 SASI_Hs02_00495006 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517504 predicted 1227
2 SASI_Hs02_00517505 predicted 1896
3 SASI_Hs02_00517506 predicted 797
4 SASI_Hs02_00517507 predicted 1448
5 SASI_Hs02_00517508 predicted 1345
6 SASI_Hs02_00517509 predicted 740
7 SASI_Hs02_00517510 predicted 780
8 SASI_Hs02_00517511 predicted 1586
9 SASI_Hs02_00517512 predicted 590
10 SASI_Hs02_00517513 predicted 750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375753
MIR137HG MISSION shRNA Bacterial Glycerol Stock
MIR137 host gene (non-protein coding)
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000131013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375753.1-445s1c1
Sequence:CCGGCGAGCAGCAAGAGTTCTGAATCTCGAGATTCAGAACTCTTGCTGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375753.1-325s1c1
Sequence:CCGGCCATTTGGATTTGGGCAGGAACTCGAGTTCCTGCCCAAATCCAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375753
MIR137HG MISSION shRNA shRNA Plasmid DNA
MIR137 host gene (non-protein coding)
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000131013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375753.1-445s1c1
Sequence:CCGGCGAGCAGCAAGAGTTCTGAATCTCGAGATTCAGAACTCTTGCTGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375753.1-325s1c1
Sequence:CCGGCCATTTGGATTTGGGCAGGAACTCGAGTTCCTGCCCAAATCCAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375753
MIR137HG MISSION shRNA Lentiviral Transduction Particles
MIR137 host gene (non-protein coding)
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000131013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375753.1-445s1c1
Sequence:CCGGCGAGCAGCAAGAGTTCTGAATCTCGAGATTCAGAACTCTTGCTGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375753.1-325s1c1
Sequence:CCGGCCATTTGGATTTGGGCAGGAACTCGAGTTCCTGCCCAAATCCAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001688
MIR137HG MISSION shRNA Bacterial Glycerol Stock
MIR137 host gene (non-protein coding)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000149314    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001688.1-1263s1c1
Sequence:CCGGGCTGTCTTTGCATTCGACATTCTCGAGAATGTCGAATGCAAAGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196187    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001688.1-689s1c1
Sequence:CCGGGCCAAACACTAAGACCAGGTTCTCGAGAACCTGGTCTTAGTGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001688.1-137s1c1
Sequence:CCGGGTGACTGTTCAGACGTCCAATCTCGAGATTGGACGTCTGAACAGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195907    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001688.1-1116s1c1
Sequence:CCGGCCACAATTACTCCCAGGGTATCTCGAGATACCCTGGGAGTAATTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001688
MIR137HG MISSION shRNA shRNA Plasmid DNA
MIR137 host gene (non-protein coding)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000149314    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001688.1-1263s1c1
Sequence:CCGGGCTGTCTTTGCATTCGACATTCTCGAGAATGTCGAATGCAAAGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196187    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001688.1-689s1c1
Sequence:CCGGGCCAAACACTAAGACCAGGTTCTCGAGAACCTGGTCTTAGTGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001688.1-137s1c1
Sequence:CCGGGTGACTGTTCAGACGTCCAATCTCGAGATTGGACGTCTGAACAGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195907    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001688.1-1116s1c1
Sequence:CCGGCCACAATTACTCCCAGGGTATCTCGAGATACCCTGGGAGTAATTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001688
MIR137HG MISSION shRNA Lentiviral Transduction Particles
MIR137 host gene (non-protein coding)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000149314    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001688.1-1263s1c1
Sequence:CCGGGCTGTCTTTGCATTCGACATTCTCGAGAATGTCGAATGCAAAGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196187    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001688.1-689s1c1
Sequence:CCGGGCCAAACACTAAGACCAGGTTCTCGAGAACCTGGTCTTAGTGTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001688.1-137s1c1
Sequence:CCGGGTGACTGTTCAGACGTCCAATCTCGAGATTGGACGTCTGAACAGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195907    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001688.1-1116s1c1
Sequence:CCGGCCACAATTACTCCCAGGGTATCTCGAGATACCCTGGGAGTAATTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)