EMAIL THIS PAGE TO A FRIEND

MIR205HG

MIR205 host gene (non-protein coding)

32 Gene Product Result for
Synonyms: LINC00510
Species: Human MIR205HG(642587)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001104548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001104548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001104548 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001104548 Rosetta Predictions human pricing
XM_931309 Rosetta Predictions human pricing
XM_931318 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323714 predicted 790
2 SASI_Hs02_00323715 predicted 536
3 SASI_Hs02_00323716 predicted 699
4 SASI_Hs02_00323717 predicted 439
5 SASI_Hs02_00323718 predicted 430
6 SASI_Hs02_00323719 predicted 759
7 SASI_Hs02_00323720 predicted 469
8 SASI_Hs02_00323721 predicted 494
9 SASI_Hs02_00323722 predicted 734
10 SASI_Hs02_00323723 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292983 predicted 791
2 SASI_Hs01_00292984 predicted 545
3 SASI_Hs01_00292985 predicted 438
4 SASI_Hs01_00292986 predicted 426
5 SASI_Hs01_00292987 predicted 760
6 SASI_Hs01_00292988 predicted 467
7 SASI_Hs01_00292989 predicted 488
8 SASI_Hs01_00292990 predicted 732
9 SASI_Hs01_00292991 predicted 467
10 SASI_Hs01_00292992 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261045 predicted 885
2 SASI_Hs01_00261046 predicted 639
3 SASI_Hs01_00261047 predicted 533
4 SASI_Hs01_00261048 predicted 516
5 SASI_Hs01_00261049 predicted 852
6 SASI_Hs01_00261050 predicted 563
7 SASI_Hs01_00261051 predicted 582
8 SASI_Hs01_00261052 predicted 833
9 SASI_Hs01_00261053 predicted 555
10 SASI_Hs01_00261054 predicted 591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001104548
MIR205HG MISSION shRNA Bacterial Glycerol Stock
MIR205 host gene (non-protein coding)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104548.1-502s21c1
Sequence:CCGGCATCTCTCAAGTACCCATCTTCTCGAGAAGATGGGTACTTGAGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104548.1-677s21c1
Sequence:CCGGAGTAACTCTGACTTAGGAATACTCGAGTATTCCTAAGTCAGAGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104548.1-470s21c1
Sequence:CCGGTGCTGAACTGGGTGCTTTATACTCGAGTATAAAGCACCCAGTTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001104548.1-706s21c1
Sequence:CCGGCAGAGAGAAATGTGATCAATGCTCGAGCATTGATCACATTTCTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104548.1-542s21c1
Sequence:CCGGTGAGGATTTCAGTGGAGTGAACTCGAGTTCACTCCACTGAAATCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001104548
MIR205HG MISSION shRNA shRNA Plasmid DNA
MIR205 host gene (non-protein coding)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104548.1-502s21c1
Sequence:CCGGCATCTCTCAAGTACCCATCTTCTCGAGAAGATGGGTACTTGAGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104548.1-677s21c1
Sequence:CCGGAGTAACTCTGACTTAGGAATACTCGAGTATTCCTAAGTCAGAGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104548.1-470s21c1
Sequence:CCGGTGCTGAACTGGGTGCTTTATACTCGAGTATAAAGCACCCAGTTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001104548.1-706s21c1
Sequence:CCGGCAGAGAGAAATGTGATCAATGCTCGAGCATTGATCACATTTCTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104548.1-542s21c1
Sequence:CCGGTGAGGATTTCAGTGGAGTGAACTCGAGTTCACTCCACTGAAATCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001104548
MIR205HG MISSION shRNA Lentiviral Transduction Particles
MIR205 host gene (non-protein coding)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104548.1-502s21c1
Sequence:CCGGCATCTCTCAAGTACCCATCTTCTCGAGAAGATGGGTACTTGAGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104548.1-677s21c1
Sequence:CCGGAGTAACTCTGACTTAGGAATACTCGAGTATTCCTAAGTCAGAGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104548.1-470s21c1
Sequence:CCGGTGCTGAACTGGGTGCTTTATACTCGAGTATAAAGCACCCAGTTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001104548.1-706s21c1
Sequence:CCGGCAGAGAGAAATGTGATCAATGCTCGAGCATTGATCACATTTCTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104548.1-542s21c1
Sequence:CCGGTGAGGATTTCAGTGGAGTGAACTCGAGTTCACTCCACTGAAATCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)