EMAIL THIS PAGE TO A FRIEND

MIR22HG

MIR22 host gene (non-protein coding)

85 Gene Product Result for
Synonyms: C17orf91
UniProtKB ID: Q0VDD5, Q0VDD6
Gene ID:
Mouse(100042498) Mir22 host gene (non-protein coding)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001870 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001870 Rosetta Predictions human pricing
NM_032895 Rosetta Predictions human pricing
XM_001478320 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053835 predicted 387
2 SASI_Hs01_00053836 predicted 425
3 SASI_Hs01_00053837 predicted 466
4 SASI_Hs01_00053838 predicted 368
5 SASI_Hs02_00303962 predicted 462
6 SASI_Hs01_00053839 predicted 456
7 SASI_Hs01_00053841 predicted 263
8 SASI_Hs01_00053842 predicted 272
9 SASI_Hs01_00053843 predicted 271
10 SASI_Hs02_00303963 predicted 375
11 SASI_Hs01_00053840 predicted 458
12 SASI_Hs01_00053844 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242438 predicted 469
2 SASI_Hs01_00242439 predicted 501
3 SASI_Hs01_00242440 predicted 549
4 SASI_Hs01_00242441 predicted 447
5 SASI_Hs02_00360516 predicted 545
6 SASI_Hs01_00242442 predicted 534
7 SASI_Hs01_00242444 predicted 348
8 SASI_Hs01_00242445 predicted 353
9 SASI_Hs01_00242446 predicted 353
10 SASI_Hs02_00360517 predicted 452
11 SASI_Hs01_00242443 predicted 547
12 SASI_Hs01_00242447 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00401845 predicted 256
2 SASI_Mm02_00401846 predicted 263
3 SASI_Mm02_00401847 predicted 118
4 SASI_Mm02_00401848 predicted 174
5 SASI_Mm02_00401849 predicted 243
6 SASI_Mm02_00401850 predicted 123
7 SASI_Mm02_00401851 predicted 8
8 SASI_Mm02_00401852 predicted 112
9 SASI_Mm02_00401853 predicted 166
10 SASI_Mm02_00401854 predicted 42
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001870
MIR22HG MISSION shRNA Bacterial Glycerol Stock
MIR22 host gene (non-protein coding)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001870.1-379s1c1
Sequence:CCGGGCTCAAACAACCCAAGGCTTTCTCGAGAAAGCCTTGGGTTGTTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001870.1-345s1c1
Sequence:CCGGGATTAGAGACACTGGCTGGATCTCGAGATCCAGCCAGTGTCTCTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001870.1-515s1c1
Sequence:CCGGCGAAAGGACACACACAGGAAACTCGAGTTTCCTGTGTGTGTCCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172678    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001870.1-775s1c1
Sequence:CCGGGCCTCCATGTCATTTGACCTACTCGAGTAGGTCAAATGACATGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001870.1-1078s1c1
Sequence:CCGGGTGCATGTTATGTGATTTCAACTCGAGTTGAAATCACATAACATGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167255    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001870.1-628s1c1
Sequence:CCGGCCTTAGCAAACCATAACAGAACTCGAGTTCTGTTATGGTTTGCTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001870
MIR22HG MISSION shRNA shRNA Plasmid DNA
MIR22 host gene (non-protein coding)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001870.1-379s1c1
Sequence:CCGGGCTCAAACAACCCAAGGCTTTCTCGAGAAAGCCTTGGGTTGTTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001870.1-345s1c1
Sequence:CCGGGATTAGAGACACTGGCTGGATCTCGAGATCCAGCCAGTGTCTCTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001870.1-515s1c1
Sequence:CCGGCGAAAGGACACACACAGGAAACTCGAGTTTCCTGTGTGTGTCCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172678    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001870.1-775s1c1
Sequence:CCGGGCCTCCATGTCATTTGACCTACTCGAGTAGGTCAAATGACATGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001870.1-1078s1c1
Sequence:CCGGGTGCATGTTATGTGATTTCAACTCGAGTTGAAATCACATAACATGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167255    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001870.1-628s1c1
Sequence:CCGGCCTTAGCAAACCATAACAGAACTCGAGTTCTGTTATGGTTTGCTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001870
MIR22HG MISSION shRNA Lentiviral Transduction Particles
MIR22 host gene (non-protein coding)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001870.1-379s1c1
Sequence:CCGGGCTCAAACAACCCAAGGCTTTCTCGAGAAAGCCTTGGGTTGTTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001870.1-345s1c1
Sequence:CCGGGATTAGAGACACTGGCTGGATCTCGAGATCCAGCCAGTGTCTCTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001870.1-515s1c1
Sequence:CCGGCGAAAGGACACACACAGGAAACTCGAGTTTCCTGTGTGTGTCCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172678    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001870.1-775s1c1
Sequence:CCGGGCCTCCATGTCATTTGACCTACTCGAGTAGGTCAAATGACATGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001870.1-1078s1c1
Sequence:CCGGGTGCATGTTATGTGATTTCAACTCGAGTTGAAATCACATAACATGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167255    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001870.1-628s1c1
Sequence:CCGGCCTTAGCAAACCATAACAGAACTCGAGTTCTGTTATGGTTTGCTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)