EMAIL THIS PAGE TO A FRIEND

MIR600HG

MIR600 host gene (non-protein coding)

32 Gene Product Result for
Synonyms: C9orf45 NCRNA00287
Species: Human MIR600HG(81571)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030814 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030814 Rosetta Predictions human pricing
XR_017965 Rosetta Predictions human pricing
XR_040211 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188711 predicted 4644
2 SASI_Hs01_00188712 predicted 5253
3 SASI_Hs01_00188713 predicted 5173
4 SASI_Hs01_00188714 predicted 5290
5 SASI_Hs01_00188715 predicted 5331
6 SASI_Hs01_00188716 predicted 4989
7 SASI_Hs01_00188717 predicted 4996
8 SASI_Hs01_00188718 predicted 5421
9 SASI_Hs01_00188719 predicted 4883
10 SASI_Hs01_00188720 predicted 5367
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495107 predicted 1111
2 SASI_Hs02_00495108 predicted 2118
3 SASI_Hs02_00495109 predicted 2145
4 SASI_Hs02_00495110 predicted 2470
5 SASI_Hs02_00495111 predicted 4185
6 SASI_Hs02_00495112 predicted 2183
7 SASI_Hs02_00495113 predicted 2491
8 SASI_Hs02_00495114 predicted 2001
9 SASI_Hs02_00495115 predicted 350
10 SASI_Hs02_00495116 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516919 predicted 3113
2 SASI_Hs02_00516920 predicted 1110
3 SASI_Hs02_00516921 predicted 2114
4 SASI_Hs02_00516922 predicted 2145
5 SASI_Hs02_00516923 predicted 2474
6 SASI_Hs02_00516924 predicted 4183
7 SASI_Hs02_00516925 predicted 2182
8 SASI_Hs02_00516926 predicted 2493
9 SASI_Hs02_00516927 predicted 1999
10 SASI_Hs02_00516928 predicted 346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030814
MIR600HG MISSION shRNA Bacterial Glycerol Stock
MIR600 host gene (non-protein coding)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030814.4-5700s1c1
Sequence:CCGGCATGTAGGACTCTGAACTTTACTCGAGTAAAGTTCAGAGTCCTACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030814.4-5613s1c1
Sequence:CCGGCCTTGGCAATAACTTTGTGTACTCGAGTACACAAAGTTATTGCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030814.4-5171s1c1
Sequence:CCGGGCCAGGTTCATCATACCGTTACTCGAGTAACGGTATGATGAACCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030814.4-5857s1c1
Sequence:CCGGGCACTGAGTATGTTGGACTCTCTCGAGAGAGTCCAACATACTCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030814.3-538s1c1
Sequence:CCGGGCTCACTTCATGTGGCAGCTTCTCGAGAAGCTGCCACATGAAGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030814.3-588s1c1
Sequence:CCGGGAGATGCTTTGCTACTACTTACTCGAGTAAGTAGTAGCAAAGCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030814
MIR600HG MISSION shRNA shRNA Plasmid DNA
MIR600 host gene (non-protein coding)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030814.4-5700s1c1
Sequence:CCGGCATGTAGGACTCTGAACTTTACTCGAGTAAAGTTCAGAGTCCTACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030814.4-5613s1c1
Sequence:CCGGCCTTGGCAATAACTTTGTGTACTCGAGTACACAAAGTTATTGCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030814.4-5171s1c1
Sequence:CCGGGCCAGGTTCATCATACCGTTACTCGAGTAACGGTATGATGAACCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030814.4-5857s1c1
Sequence:CCGGGCACTGAGTATGTTGGACTCTCTCGAGAGAGTCCAACATACTCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030814.3-538s1c1
Sequence:CCGGGCTCACTTCATGTGGCAGCTTCTCGAGAAGCTGCCACATGAAGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030814.3-588s1c1
Sequence:CCGGGAGATGCTTTGCTACTACTTACTCGAGTAAGTAGTAGCAAAGCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030814
MIR600HG MISSION shRNA Lentiviral Transduction Particles
MIR600 host gene (non-protein coding)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030814.4-5700s1c1
Sequence:CCGGCATGTAGGACTCTGAACTTTACTCGAGTAAAGTTCAGAGTCCTACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030814.4-5613s1c1
Sequence:CCGGCCTTGGCAATAACTTTGTGTACTCGAGTACACAAAGTTATTGCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030814.4-5171s1c1
Sequence:CCGGGCCAGGTTCATCATACCGTTACTCGAGTAACGGTATGATGAACCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030814.4-5857s1c1
Sequence:CCGGGCACTGAGTATGTTGGACTCTCTCGAGAGAGTCCAACATACTCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030814.3-538s1c1
Sequence:CCGGGCTCACTTCATGTGGCAGCTTCTCGAGAAGCTGCCACATGAAGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030814.3-588s1c1
Sequence:CCGGGAGATGCTTTGCTACTACTTACTCGAGTAAGTAGTAGCAAAGCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)