EMAIL THIS PAGE TO A FRIEND

MIR7-3HG

MIR7-3 host gene (non-protein coding)

42 Gene Product Result for
Synonyms: C19orf30 LINC00306 NCRNA00306 PGSF1
Species: Human MIR7-3HG(284424)
UniProtKB ID: Q8N6C7, D6W630, Q17RJ9, Q8N6C6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174947 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174947 Rosetta Predictions human pricing
XR_040340 Rosetta Predictions human pricing
XR_040341 Rosetta Predictions human pricing
XR_040342 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022904 predicted 206
2 SASI_Hs01_00022905 predicted 297
3 SASI_Hs01_00022906 predicted 306
4 SASI_Hs01_00022907 predicted 254
5 SASI_Hs01_00022908 predicted 250
6 SASI_Hs01_00022909 predicted 239
7 SASI_Hs01_00022910 predicted 298
8 SASI_Hs01_00022911 predicted 207
9 SASI_Hs01_00022912 predicted 252
10 SASI_Hs01_00022913 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517972 predicted 196
2 SASI_Hs02_00517973 predicted 300
3 SASI_Hs02_00517974 predicted 294
4 SASI_Hs02_00517975 predicted 251
5 SASI_Hs02_00517976 predicted 246
6 SASI_Hs02_00517977 predicted 231
7 SASI_Hs02_00517978 predicted 293
8 SASI_Hs02_00517979 predicted 201
9 SASI_Hs02_00517980 predicted 243
10 SASI_Hs02_00517981 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517982 predicted 201
2 SASI_Hs02_00517983 predicted 300
3 SASI_Hs02_00517984 predicted 299
4 SASI_Hs02_00517985 predicted 248
5 SASI_Hs02_00517986 predicted 250
6 SASI_Hs02_00517987 predicted 233
7 SASI_Hs02_00517988 predicted 296
8 SASI_Hs02_00517989 predicted 196
9 SASI_Hs02_00517990 predicted 246
10 SASI_Hs02_00517991 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517992 predicted 147
2 SASI_Hs02_00517993 predicted 157
3 SASI_Hs02_00517994 predicted 45
4 SASI_Hs02_00517995 predicted 153
5 SASI_Hs02_00517996 predicted 153
6 SASI_Hs02_00517997 predicted 81
7 SASI_Hs02_00517998 predicted 286
8 SASI_Hs02_00517999 predicted 295
9 SASI_Hs02_00518000 predicted 248
10 SASI_Hs02_00518001 predicted 154
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174947
MIR7-3HG MISSION shRNA Bacterial Glycerol Stock
MIR7-3 host gene (non-protein coding)
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000173026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174947.2-161s1c1
Sequence:CCGGCGAAGTTTGACGGTCTGGAAACTCGAGTTTCCAGACCGTCAAACTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174947.2-393s1c1
Sequence:CCGGCCTTCTTCTGCAAGCTCCATTCTCGAGAATGGAGCTTGCAGAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174947
MIR7-3HG MISSION shRNA shRNA Plasmid DNA
MIR7-3 host gene (non-protein coding)
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000173026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174947.2-161s1c1
Sequence:CCGGCGAAGTTTGACGGTCTGGAAACTCGAGTTTCCAGACCGTCAAACTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174947.2-393s1c1
Sequence:CCGGCCTTCTTCTGCAAGCTCCATTCTCGAGAATGGAGCTTGCAGAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174947
MIR7-3HG MISSION shRNA Lentiviral Transduction Particles
MIR7-3 host gene (non-protein coding)
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000173026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174947.2-161s1c1
Sequence:CCGGCGAAGTTTGACGGTCTGGAAACTCGAGTTTCCAGACCGTCAAACTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174947.2-393s1c1
Sequence:CCGGCCTTCTTCTGCAAGCTCCATTCTCGAGAATGGAGCTTGCAGAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)