EMAIL THIS PAGE TO A FRIEND

MIS18A

MIS18 kinetochore protein homolog A (S. pombe)

60 Gene Product Result for
Synonyms: B28 C21orf45 C21orf46 FASP1 MIS18alpha hMis18alpha
UniProtKB ID: Q9NYP9, B2R562, Q542Z0
Gene ID:
Mouse(66578) MIS18 kinetochore protein homolog A (S. pombe)
Rat(288272) MIS18 kinetochore protein homolog A (S. pombe)
sheep(101113820) MIS18 kinetochore protein homolog A (S. pombe)
naked mole-rat(101715768) MIS18 kinetochore protein homolog A (S. pombe)
domestic guinea pig(100718299) MIS18 kinetochore protein homolog A (S. pombe)
Zebrafish(553502) MIS18 kinetochore protein homolog A (S. pombe)
cow(510809) MIS18 kinetochore protein homolog A (S. pombe)
dog(609701) MIS18 kinetochore protein homolog A (S. pombe)
chicken(418494) MIS18 kinetochore protein homolog A (S. pombe)
domestic cat(101091551) MIS18 kinetochore protein homolog A (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018944 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025642 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025642 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025642 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018944 Rosetta Predictions human pricing
NM_001127523 Rosetta Predictions rat pricing
XM_221670 Rosetta Predictions rat pricing
NM_025642 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050500 predicted 410
2 SASI_Hs01_00050501 predicted 476
3 SASI_Hs01_00050502 predicted 412
4 SASI_Hs01_00050504 predicted 507
5 SASI_Hs01_00050506 predicted 442
6 SASI_Hs01_00050507 predicted 1237
7 SASI_Hs01_00050508 predicted 478
8 SASI_Hs02_00352404 predicted 1244
9 SASI_Hs02_00352405 predicted 505
10 SASI_Hs02_00352406 predicted 1204
11 SASI_Hs01_00050503 predicted 377
12 SASI_Hs01_00050505 predicted 381
13 SASI_Hs01_00050509 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253983 predicted 460
2 SASI_Rn02_00253984 predicted 216
3 SASI_Rn02_00253985 predicted 482
4 SASI_Rn02_00253986 predicted 233
5 SASI_Rn02_00253987 predicted 389
6 SASI_Rn02_00253988 predicted 509
7 SASI_Rn02_00253989 predicted 356
8 SASI_Rn02_00253990 predicted 642
9 SASI_Rn02_00253991 predicted 659
10 SASI_Rn02_00253992 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135347 predicted 490
2 SASI_Rn01_00135348 predicted 251
3 SASI_Rn01_00135349 predicted 518
4 SASI_Rn01_00135350 predicted 266
5 SASI_Rn01_00135351 predicted 534
6 SASI_Rn01_00135352 predicted 422
7 SASI_Rn01_00135353 predicted 392
8 SASI_Rn01_00135354 predicted 374
9 SASI_Rn01_00135355 predicted 387
10 SASI_Rn01_00135356 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025642 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328734 predicted 523
2 SASI_Mm02_00328735 predicted 500
3 SASI_Mm02_00328736 predicted 638
4 SASI_Mm02_00328737 predicted 512
5 SASI_Mm02_00328738 predicted 520
6 SASI_Mm02_00328739 predicted 593
7 SASI_Mm02_00328740 predicted 668
8 SASI_Mm02_00328741 predicted 246
9 SASI_Mm02_00328742 predicted 363
10 SASI_Mm02_00328743 predicted 660
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018944
MIS18A MISSION shRNA Bacterial Glycerol Stock
MIS18 kinetochore protein homolog A (S. pombe)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018944.2-715s21c1
Sequence:CCGGGCCGAATCCAAATTGTCCTTTCTCGAGAAAGGACAATTTGGATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018944.2-553s1c1
Sequence:CCGGCTCAGTGTTGAAGCCATTGAACTCGAGTTCAATGGCTTCAACACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018944.2-378s1c1
Sequence:CCGGGCTTCGCTGTGTTTCCTGTAACTCGAGTTACAGGAAACACAGCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018944.2-715s1c1
Sequence:CCGGGCCGAATCCAAATTGTCCTTTCTCGAGAAAGGACAATTTGGATTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018944.2-379s1c1
Sequence:CCGGCTTCGCTGTGTTTCCTGTAATCTCGAGATTACAGGAAACACAGCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018944.2-516s1c1
Sequence:CCGGGCCCAAGAATCTTGATTACAACTCGAGTTGTAATCAAGATTCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018944.2-516s21c1
Sequence:CCGGGCCCAAGAATCTTGATTACAACTCGAGTTGTAATCAAGATTCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018944.2-379s21c1
Sequence:CCGGCTTCGCTGTGTTTCCTGTAATCTCGAGATTACAGGAAACACAGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018944.2-553s21c1
Sequence:CCGGCTCAGTGTTGAAGCCATTGAACTCGAGTTCAATGGCTTCAACACTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018944
MIS18A MISSION shRNA shRNA Plasmid DNA
MIS18 kinetochore protein homolog A (S. pombe)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018944.2-715s21c1
Sequence:CCGGGCCGAATCCAAATTGTCCTTTCTCGAGAAAGGACAATTTGGATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018944.2-553s1c1
Sequence:CCGGCTCAGTGTTGAAGCCATTGAACTCGAGTTCAATGGCTTCAACACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018944.2-378s1c1
Sequence:CCGGGCTTCGCTGTGTTTCCTGTAACTCGAGTTACAGGAAACACAGCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018944.2-715s1c1
Sequence:CCGGGCCGAATCCAAATTGTCCTTTCTCGAGAAAGGACAATTTGGATTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018944.2-379s1c1
Sequence:CCGGCTTCGCTGTGTTTCCTGTAATCTCGAGATTACAGGAAACACAGCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018944.2-516s1c1
Sequence:CCGGGCCCAAGAATCTTGATTACAACTCGAGTTGTAATCAAGATTCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018944.2-516s21c1
Sequence:CCGGGCCCAAGAATCTTGATTACAACTCGAGTTGTAATCAAGATTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018944.2-379s21c1
Sequence:CCGGCTTCGCTGTGTTTCCTGTAATCTCGAGATTACAGGAAACACAGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018944.2-553s21c1
Sequence:CCGGCTCAGTGTTGAAGCCATTGAACTCGAGTTCAATGGCTTCAACACTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018944
MIS18A MISSION shRNA Lentiviral Transduction Particles
MIS18 kinetochore protein homolog A (S. pombe)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018944.2-715s21c1
Sequence:CCGGGCCGAATCCAAATTGTCCTTTCTCGAGAAAGGACAATTTGGATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018944.2-553s1c1
Sequence:CCGGCTCAGTGTTGAAGCCATTGAACTCGAGTTCAATGGCTTCAACACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018944.2-378s1c1
Sequence:CCGGGCTTCGCTGTGTTTCCTGTAACTCGAGTTACAGGAAACACAGCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018944.2-715s1c1
Sequence:CCGGGCCGAATCCAAATTGTCCTTTCTCGAGAAAGGACAATTTGGATTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018944.2-379s1c1
Sequence:CCGGCTTCGCTGTGTTTCCTGTAATCTCGAGATTACAGGAAACACAGCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018944.2-516s1c1
Sequence:CCGGGCCCAAGAATCTTGATTACAACTCGAGTTGTAATCAAGATTCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018944.2-516s21c1
Sequence:CCGGGCCCAAGAATCTTGATTACAACTCGAGTTGTAATCAAGATTCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018944.2-379s21c1
Sequence:CCGGCTTCGCTGTGTTTCCTGTAATCTCGAGATTACAGGAAACACAGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018944.2-553s21c1
Sequence:CCGGCTCAGTGTTGAAGCCATTGAACTCGAGTTCAATGGCTTCAACACTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025642
VALIDATED
MIS18A MISSION shRNA Bacterial Glycerol Stock
MIS18 kinetochore protein homolog A (S. pombe)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000268741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025642.1-595s21c1
Sequence:CCGGCTTGAAAGCCGAGTTGAAATACTCGAGTATTTCAACTCGGCTTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025642.1-355s21c1
Sequence:CCGGTGTAACGTCTCTGTGGATAAGCTCGAGCTTATCCACAGAGACGTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025642.1-790s21c1
Sequence:CCGGGGTAACCGTTTCCCGTGTTTGCTCGAGCAAACACGGGAAACGGTTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025642.1-667s21c1
Sequence:CCGGCTACGGGAAGTTGAATCTAAACTCGAGTTTAGATTCAACTTCCCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025642
VALIDATED
MIS18A MISSION shRNA shRNA Plasmid DNA
MIS18 kinetochore protein homolog A (S. pombe)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000268741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025642.1-595s21c1
Sequence:CCGGCTTGAAAGCCGAGTTGAAATACTCGAGTATTTCAACTCGGCTTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025642.1-355s21c1
Sequence:CCGGTGTAACGTCTCTGTGGATAAGCTCGAGCTTATCCACAGAGACGTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025642.1-790s21c1
Sequence:CCGGGGTAACCGTTTCCCGTGTTTGCTCGAGCAAACACGGGAAACGGTTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025642.1-667s21c1
Sequence:CCGGCTACGGGAAGTTGAATCTAAACTCGAGTTTAGATTCAACTTCCCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025642
VALIDATED
MIS18A MISSION shRNA Lentiviral Transduction Particles
MIS18 kinetochore protein homolog A (S. pombe)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000268741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025642.1-595s21c1
Sequence:CCGGCTTGAAAGCCGAGTTGAAATACTCGAGTATTTCAACTCGGCTTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025642.1-355s21c1
Sequence:CCGGTGTAACGTCTCTGTGGATAAGCTCGAGCTTATCCACAGAGACGTTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025642.1-790s21c1
Sequence:CCGGGGTAACCGTTTCCCGTGTTTGCTCGAGCAAACACGGGAAACGGTTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025642.1-667s21c1
Sequence:CCGGCTACGGGAAGTTGAATCTAAACTCGAGTTTAGATTCAACTTCCCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)