EMAIL THIS PAGE TO A FRIEND

MIS18BP1

MIS18 binding protein 1

49 Gene Product Result for
Synonyms: C14orf106 HSA242977 KNL2 M18BP1
UniProtKB ID: Q6P0N0, D3DSA7, Q86V14, Q96PY4, Q9NUR5, Q9Y4X9
Gene ID:
Mouse(217653) MIS18 binding protein 1
Rat(689296) MIS18 binding protein 1
chicken(423593) MIS18 binding protein 1
dog(100682620) MIS18 binding protein 1
Horse(100063818) MIS18 binding protein 1
cow(507661) MIS18 binding protein 1
domestic cat(101089524) MIS18 binding protein 1
domestic guinea pig(100715607) MIS18 binding protein 1
naked mole-rat(101713375) MIS18 binding protein 1
sheep(101106368) MIS18 binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018353 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018353 Rosetta Predictions human pricing
NM_001109531 Rosetta Predictions rat pricing
NM_172578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219218 predicted 2893
2 SASI_Hs01_00219219 predicted 1740
3 SASI_Hs01_00219221 predicted 1014
4 SASI_Hs01_00219222 predicted 3237
5 SASI_Hs01_00219223 predicted 2080
6 SASI_Hs02_00351811 predicted 3254
7 SASI_Hs01_00219224 predicted 2773
8 SASI_Hs01_00219225 predicted 1611
9 SASI_Hs01_00219226 predicted 3571
10 SASI_Hs01_00219227 predicted 2661
11 SASI_Hs01_00219220 predicted 3323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249319 predicted 1050
2 SASI_Rn02_00249320 predicted 3275
3 SASI_Rn02_00249321 predicted 1830
4 SASI_Rn02_00249322 predicted 1480
5 SASI_Rn02_00249323 predicted 1685
6 SASI_Rn02_00249324 predicted 1378
7 SASI_Rn02_00249325 predicted 957
8 SASI_Rn02_00249326 predicted 1560
9 SASI_Rn02_00249327 predicted 2341
10 SASI_Rn02_00249328 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069317 predicted 3238
2 SASI_Mm01_00069318 predicted 1151
3 SASI_Mm02_00344245 predicted 1297
4 SASI_Mm01_00069319 predicted 907
5 SASI_Mm01_00069320 predicted 987
6 SASI_Mm01_00069321 predicted 1786
7 SASI_Mm01_00069322 predicted 284
8 SASI_Mm01_00069323 predicted 2278
9 SASI_Mm01_00069324 predicted 2694
10 SASI_Mm01_00069316 predicted 1335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018353
VALIDATED
MIS18BP1 MISSION shRNA Bacterial Glycerol Stock
MIS18 binding protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018353.3-2764s1c1
Sequence:CCGGCGTCAAAGAAACTCTTCAGAACTCGAGTTCTGAAGAGTTTCTTTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018353.3-1519s1c1
Sequence:CCGGGCACAACAAACTTAGGACTATCTCGAGATAGTCCTAAGTTTGTTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018353.3-1744s1c1
Sequence:CCGGCCGTGACATAAGGAAATCAATCTCGAGATTGATTTCCTTATGTCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018353.3-3385s1c1
Sequence:CCGGGCTAGGTTCTATAAATAGGAACTCGAGTTCCTATTTATAGAACCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018353.3-2391s1c1
Sequence:CCGGGCGATGAACGTGACTTACTTACTCGAGTAAGTAAGTCACGTTCATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018353.4-4293s21c1
Sequence:CCGGATCCAAGCCAGAGTAGGATTTCTCGAGAAATCCTACTCTGGCTTGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018353.4-4016s21c1
Sequence:CCGGTCATTGCTGCAGCTTACTAAACTCGAGTTTAGTAAGCTGCAGCAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018353.4-1314s21c1
Sequence:CCGGTGAGACTCTCAGTACTAATTGCTCGAGCAATTAGTACTGAGAGTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018353
VALIDATED
MIS18BP1 MISSION shRNA shRNA Plasmid DNA
MIS18 binding protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018353.3-2764s1c1
Sequence:CCGGCGTCAAAGAAACTCTTCAGAACTCGAGTTCTGAAGAGTTTCTTTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018353.3-1519s1c1
Sequence:CCGGGCACAACAAACTTAGGACTATCTCGAGATAGTCCTAAGTTTGTTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018353.3-1744s1c1
Sequence:CCGGCCGTGACATAAGGAAATCAATCTCGAGATTGATTTCCTTATGTCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018353.3-3385s1c1
Sequence:CCGGGCTAGGTTCTATAAATAGGAACTCGAGTTCCTATTTATAGAACCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018353.3-2391s1c1
Sequence:CCGGGCGATGAACGTGACTTACTTACTCGAGTAAGTAAGTCACGTTCATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018353.4-4293s21c1
Sequence:CCGGATCCAAGCCAGAGTAGGATTTCTCGAGAAATCCTACTCTGGCTTGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018353.4-4016s21c1
Sequence:CCGGTCATTGCTGCAGCTTACTAAACTCGAGTTTAGTAAGCTGCAGCAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018353.4-1314s21c1
Sequence:CCGGTGAGACTCTCAGTACTAATTGCTCGAGCAATTAGTACTGAGAGTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018353
VALIDATED
MIS18BP1 MISSION shRNA Lentiviral Transduction Particles
MIS18 binding protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018353.3-2764s1c1
Sequence:CCGGCGTCAAAGAAACTCTTCAGAACTCGAGTTCTGAAGAGTTTCTTTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018353.3-1519s1c1
Sequence:CCGGGCACAACAAACTTAGGACTATCTCGAGATAGTCCTAAGTTTGTTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018353.3-1744s1c1
Sequence:CCGGCCGTGACATAAGGAAATCAATCTCGAGATTGATTTCCTTATGTCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018353.3-3385s1c1
Sequence:CCGGGCTAGGTTCTATAAATAGGAACTCGAGTTCCTATTTATAGAACCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018353.3-2391s1c1
Sequence:CCGGGCGATGAACGTGACTTACTTACTCGAGTAAGTAAGTCACGTTCATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018353.4-4293s21c1
Sequence:CCGGATCCAAGCCAGAGTAGGATTTCTCGAGAAATCCTACTCTGGCTTGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018353.4-4016s21c1
Sequence:CCGGTCATTGCTGCAGCTTACTAAACTCGAGTTTAGTAAGCTGCAGCAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018353.4-1314s21c1
Sequence:CCGGTGAGACTCTCAGTACTAATTGCTCGAGCAATTAGTACTGAGAGTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172578
VALIDATED
MIS18BP1 MISSION shRNA Bacterial Glycerol Stock
MIS18 binding protein 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193960    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172578.2-3515s1c1
Sequence:CCGGGCCTTAAATGAGGAGAGGTAACTCGAGTTACCTCTCCTCATTTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172578.2-1818s1c1
Sequence:CCGGGTCTCTCTATTGAAGGAATATCTCGAGATATTCCTTCAATAGAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172578.2-2957s1c1
Sequence:CCGGGCCGCTATAGAAAGGAATAATCTCGAGATTATTCCTTTCTATAGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172578.2-2468s1c1
Sequence:CCGGCAAGAGTTACAGAAGCTACATCTCGAGATGTAGCTTCTGTAACTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172578.2-3366s1c1
Sequence:CCGGGCTTACAAATACTTTGCCTATCTCGAGATAGGCAAAGTATTTGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172578.2-3808s1c1
Sequence:CCGGCCCTGCTATATCTATCTGATACTCGAGTATCAGATAGATATAGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172578.2-1635s1c1
Sequence:CCGGCGTATGACCTTAATGATAATACTCGAGTATTATCATTAAGGTCATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172578.2-1354s1c1
Sequence:CCGGCAATGAACTTAGGACCTTATCCTCGAGGATAAGGTCCTAAGTTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172578.2-682s1c1
Sequence:CCGGGAAAGCTCAGTTGCAACAAACCTCGAGGTTTGTTGCAACTGAGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172578.2-1818s21c1
Sequence:CCGGGTCTCTCTATTGAAGGAATATCTCGAGATATTCCTTCAATAGAGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172578.2-2468s21c1
Sequence:CCGGCAAGAGTTACAGAAGCTACATCTCGAGATGTAGCTTCTGTAACTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172578.2-3808s21c1
Sequence:CCGGCCCTGCTATATCTATCTGATACTCGAGTATCAGATAGATATAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172578.2-2957s21c1
Sequence:CCGGGCCGCTATAGAAAGGAATAATCTCGAGATTATTCCTTTCTATAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172578
VALIDATED
MIS18BP1 MISSION shRNA shRNA Plasmid DNA
MIS18 binding protein 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193960    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172578.2-3515s1c1
Sequence:CCGGGCCTTAAATGAGGAGAGGTAACTCGAGTTACCTCTCCTCATTTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172578.2-1818s1c1
Sequence:CCGGGTCTCTCTATTGAAGGAATATCTCGAGATATTCCTTCAATAGAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172578.2-2957s1c1
Sequence:CCGGGCCGCTATAGAAAGGAATAATCTCGAGATTATTCCTTTCTATAGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172578.2-2468s1c1
Sequence:CCGGCAAGAGTTACAGAAGCTACATCTCGAGATGTAGCTTCTGTAACTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172578.2-3366s1c1
Sequence:CCGGGCTTACAAATACTTTGCCTATCTCGAGATAGGCAAAGTATTTGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172578.2-3808s1c1
Sequence:CCGGCCCTGCTATATCTATCTGATACTCGAGTATCAGATAGATATAGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172578.2-1635s1c1
Sequence:CCGGCGTATGACCTTAATGATAATACTCGAGTATTATCATTAAGGTCATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172578.2-1354s1c1
Sequence:CCGGCAATGAACTTAGGACCTTATCCTCGAGGATAAGGTCCTAAGTTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172578.2-682s1c1
Sequence:CCGGGAAAGCTCAGTTGCAACAAACCTCGAGGTTTGTTGCAACTGAGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172578.2-1818s21c1
Sequence:CCGGGTCTCTCTATTGAAGGAATATCTCGAGATATTCCTTCAATAGAGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172578.2-2468s21c1
Sequence:CCGGCAAGAGTTACAGAAGCTACATCTCGAGATGTAGCTTCTGTAACTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172578.2-3808s21c1
Sequence:CCGGCCCTGCTATATCTATCTGATACTCGAGTATCAGATAGATATAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172578.2-2957s21c1
Sequence:CCGGGCCGCTATAGAAAGGAATAATCTCGAGATTATTCCTTTCTATAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172578
VALIDATED
MIS18BP1 MISSION shRNA Lentiviral Transduction Particles
MIS18 binding protein 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193960    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172578.2-3515s1c1
Sequence:CCGGGCCTTAAATGAGGAGAGGTAACTCGAGTTACCTCTCCTCATTTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172578.2-1818s1c1
Sequence:CCGGGTCTCTCTATTGAAGGAATATCTCGAGATATTCCTTCAATAGAGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172578.2-2957s1c1
Sequence:CCGGGCCGCTATAGAAAGGAATAATCTCGAGATTATTCCTTTCTATAGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172578.2-2468s1c1
Sequence:CCGGCAAGAGTTACAGAAGCTACATCTCGAGATGTAGCTTCTGTAACTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172578.2-3366s1c1
Sequence:CCGGGCTTACAAATACTTTGCCTATCTCGAGATAGGCAAAGTATTTGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172578.2-3808s1c1
Sequence:CCGGCCCTGCTATATCTATCTGATACTCGAGTATCAGATAGATATAGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172578.2-1635s1c1
Sequence:CCGGCGTATGACCTTAATGATAATACTCGAGTATTATCATTAAGGTCATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172578.2-1354s1c1
Sequence:CCGGCAATGAACTTAGGACCTTATCCTCGAGGATAAGGTCCTAAGTTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172578.2-682s1c1
Sequence:CCGGGAAAGCTCAGTTGCAACAAACCTCGAGGTTTGTTGCAACTGAGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172578.2-1818s21c1
Sequence:CCGGGTCTCTCTATTGAAGGAATATCTCGAGATATTCCTTCAATAGAGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172578.2-2468s21c1
Sequence:CCGGCAAGAGTTACAGAAGCTACATCTCGAGATGTAGCTTCTGTAACTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172578.2-3808s21c1
Sequence:CCGGCCCTGCTATATCTATCTGATACTCGAGTATCAGATAGATATAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172578.2-2957s21c1
Sequence:CCGGGCCGCTATAGAAAGGAATAATCTCGAGATTATTCCTTTCTATAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)