EMAIL THIS PAGE TO A FRIEND

MISP

mitotic spindle positioning

50 Gene Product Result for
Synonyms: C19orf21
UniProtKB ID: Q8IVT2
Gene ID:
Mouse(78906) mitotic spindle positioning
Rat(500797) mitotic spindle positioning
naked mole-rat(101718194) mitotic spindle positioning
domestic guinea pig(100724134) mitotic spindle positioning
cow(505316) mitotic spindle positioning
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173481 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030218 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030218 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030218 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173481 Rosetta Predictions human pricing
NM_001109284 Rosetta Predictions rat pricing
NM_030218 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108053 predicted 1705
2 SASI_Hs02_00368241 predicted 1708
3 SASI_Hs01_00108054 predicted 2444
4 SASI_Hs01_00108055 predicted 2393
5 SASI_Hs01_00108056 predicted 2442
6 SASI_Hs01_00108057 predicted 2394
7 SASI_Hs01_00108059 predicted 2480
8 SASI_Hs01_00108060 predicted 2266
9 SASI_Hs01_00108061 predicted 1871
10 SASI_Hs01_00108062 predicted 1968
11 SASI_Hs01_00108058 predicted 2367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246904 predicted 1844
2 SASI_Rn02_00246905 predicted 1541
3 SASI_Rn02_00246906 predicted 1541
4 SASI_Rn02_00246907 predicted 2019
5 SASI_Rn02_00246908 predicted 1291
6 SASI_Rn02_00246909 predicted 1372
7 SASI_Rn02_00246910 predicted 2088
8 SASI_Rn02_00246911 predicted 377
9 SASI_Rn02_00246912 predicted 1550
10 SASI_Rn02_00246913 predicted 1753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120120 predicted 1820
2 SASI_Mm01_00120121 predicted 630
3 SASI_Mm01_00120122 predicted 2000
4 SASI_Mm01_00120123 predicted 1112
5 SASI_Mm01_00120126 predicted 825
6 SASI_Mm01_00120127 predicted 1499
7 SASI_Mm02_00336643 predicted 833
8 SASI_Mm01_00120128 predicted 1272
9 SASI_Mm02_00336644 predicted 1270
10 SASI_Mm02_00336645 predicted 1937
11 SASI_Mm01_00120124 predicted 1444
12 SASI_Mm01_00120125 predicted 365
13 SASI_Mm01_00120129 predicted 1931
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173481
VALIDATED
MISP MISSION shRNA Bacterial Glycerol Stock
mitotic spindle positioning
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173481.2-1908s21c1
Sequence:CCGGCCCATCCACCTACACTCAAACCTCGAGGTTTGAGTGTAGGTGGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173481.2-348s21c1
Sequence:CCGGGATGAGGGTTGGCAGGTTTACCTCGAGGTAAACCTGCCAACCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173481.2-2296s21c1
Sequence:CCGGTTCCGTTTCTATCTTCCTTTACTCGAGTAAAGGAAGATAGAAACGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173481.2-1131s21c1
Sequence:CCGGTACGTGCAGCGGGACATAGTACTCGAGTACTATGTCCCGCTGCACGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_173481.2-2370s1c1
Sequence:CCGGGCTGATTCTTTCTGCTTCTAACTCGAGTTAGAAGCAGAAAGAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173481.2-1385s1c1
Sequence:CCGGCCAGCTAGAATTCTCAGCCTTCTCGAGAAGGCTGAGAATTCTAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_173481.2-159s1c1
Sequence:CCGGGACACCAGCTACACATACCATCTCGAGATGGTATGTGTAGCTGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_173481.2-2081s1c1
Sequence:CCGGGCGCTGGGAATCCCGCATCTACTCGAGTAGATGCGGGATTCCCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_173481.2-1707s1c1
Sequence:CCGGCAGTCATCTGATCTGCTGGAACTCGAGTTCCAGCAGATCAGATGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173481
VALIDATED
MISP MISSION shRNA shRNA Plasmid DNA
mitotic spindle positioning
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173481.2-1908s21c1
Sequence:CCGGCCCATCCACCTACACTCAAACCTCGAGGTTTGAGTGTAGGTGGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173481.2-348s21c1
Sequence:CCGGGATGAGGGTTGGCAGGTTTACCTCGAGGTAAACCTGCCAACCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173481.2-2296s21c1
Sequence:CCGGTTCCGTTTCTATCTTCCTTTACTCGAGTAAAGGAAGATAGAAACGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173481.2-1131s21c1
Sequence:CCGGTACGTGCAGCGGGACATAGTACTCGAGTACTATGTCCCGCTGCACGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_173481.2-2370s1c1
Sequence:CCGGGCTGATTCTTTCTGCTTCTAACTCGAGTTAGAAGCAGAAAGAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173481.2-1385s1c1
Sequence:CCGGCCAGCTAGAATTCTCAGCCTTCTCGAGAAGGCTGAGAATTCTAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_173481.2-159s1c1
Sequence:CCGGGACACCAGCTACACATACCATCTCGAGATGGTATGTGTAGCTGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_173481.2-2081s1c1
Sequence:CCGGGCGCTGGGAATCCCGCATCTACTCGAGTAGATGCGGGATTCCCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_173481.2-1707s1c1
Sequence:CCGGCAGTCATCTGATCTGCTGGAACTCGAGTTCCAGCAGATCAGATGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173481
VALIDATED
MISP MISSION shRNA Lentiviral Transduction Particles
mitotic spindle positioning
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173481.2-1908s21c1
Sequence:CCGGCCCATCCACCTACACTCAAACCTCGAGGTTTGAGTGTAGGTGGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173481.2-348s21c1
Sequence:CCGGGATGAGGGTTGGCAGGTTTACCTCGAGGTAAACCTGCCAACCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173481.2-2296s21c1
Sequence:CCGGTTCCGTTTCTATCTTCCTTTACTCGAGTAAAGGAAGATAGAAACGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173481.2-1131s21c1
Sequence:CCGGTACGTGCAGCGGGACATAGTACTCGAGTACTATGTCCCGCTGCACGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_173481.2-2370s1c1
Sequence:CCGGGCTGATTCTTTCTGCTTCTAACTCGAGTTAGAAGCAGAAAGAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173481.2-1385s1c1
Sequence:CCGGCCAGCTAGAATTCTCAGCCTTCTCGAGAAGGCTGAGAATTCTAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_173481.2-159s1c1
Sequence:CCGGGACACCAGCTACACATACCATCTCGAGATGGTATGTGTAGCTGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_173481.2-2081s1c1
Sequence:CCGGGCGCTGGGAATCCCGCATCTACTCGAGTAGATGCGGGATTCCCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_173481.2-1707s1c1
Sequence:CCGGCAGTCATCTGATCTGCTGGAACTCGAGTTCCAGCAGATCAGATGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030218
MISP MISSION shRNA Bacterial Glycerol Stock
mitotic spindle positioning
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030218.2-801s21c1
Sequence:CCGGGTGACCCTGGAGAAGTCTTTCCTCGAGGAAAGACTTCTCCAGGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030218.2-832s21c1
Sequence:CCGGCAGCTAGATCCATCCATATAGCTCGAGCTATATGGATGGATCTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030218.2-2142s21c1
Sequence:CCGGAGTCTCTGCTGTCCCTATTTACTCGAGTAAATAGGGACAGCAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030218.2-387s21c1
Sequence:CCGGGATGAGGAGATAAAGTCTTATCTCGAGATAAGACTTTATCTCCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030218.1-2260s1c1
Sequence:CCGGCTGAAATGATAATCCACCGATCTCGAGATCGGTGGATTATCATTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030218.1-2013s1c1
Sequence:CCGGCACAAGAATCTCTTGGCGGAACTCGAGTTCCGCCAAGAGATTCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030218.1-1516s1c1
Sequence:CCGGGTGTGGTGAGATTAGGGAATTCTCGAGAATTCCCTAATCTCACCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030218.1-187s1c1
Sequence:CCGGGCTTGGTACTGGATGAAGATACTCGAGTATCTTCATCCAGTACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030218.1-295s1c1
Sequence:CCGGCCAGACCAGATGTAAAGAGAACTCGAGTTCTCTTTACATCTGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030218
MISP MISSION shRNA shRNA Plasmid DNA
mitotic spindle positioning
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030218.2-801s21c1
Sequence:CCGGGTGACCCTGGAGAAGTCTTTCCTCGAGGAAAGACTTCTCCAGGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030218.2-832s21c1
Sequence:CCGGCAGCTAGATCCATCCATATAGCTCGAGCTATATGGATGGATCTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030218.2-2142s21c1
Sequence:CCGGAGTCTCTGCTGTCCCTATTTACTCGAGTAAATAGGGACAGCAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030218.2-387s21c1
Sequence:CCGGGATGAGGAGATAAAGTCTTATCTCGAGATAAGACTTTATCTCCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030218.1-2260s1c1
Sequence:CCGGCTGAAATGATAATCCACCGATCTCGAGATCGGTGGATTATCATTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030218.1-2013s1c1
Sequence:CCGGCACAAGAATCTCTTGGCGGAACTCGAGTTCCGCCAAGAGATTCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030218.1-1516s1c1
Sequence:CCGGGTGTGGTGAGATTAGGGAATTCTCGAGAATTCCCTAATCTCACCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030218.1-187s1c1
Sequence:CCGGGCTTGGTACTGGATGAAGATACTCGAGTATCTTCATCCAGTACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030218.1-295s1c1
Sequence:CCGGCCAGACCAGATGTAAAGAGAACTCGAGTTCTCTTTACATCTGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030218
MISP MISSION shRNA Lentiviral Transduction Particles
mitotic spindle positioning
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030218.2-801s21c1
Sequence:CCGGGTGACCCTGGAGAAGTCTTTCCTCGAGGAAAGACTTCTCCAGGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030218.2-832s21c1
Sequence:CCGGCAGCTAGATCCATCCATATAGCTCGAGCTATATGGATGGATCTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030218.2-2142s21c1
Sequence:CCGGAGTCTCTGCTGTCCCTATTTACTCGAGTAAATAGGGACAGCAGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030218.2-387s21c1
Sequence:CCGGGATGAGGAGATAAAGTCTTATCTCGAGATAAGACTTTATCTCCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030218.1-2260s1c1
Sequence:CCGGCTGAAATGATAATCCACCGATCTCGAGATCGGTGGATTATCATTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030218.1-2013s1c1
Sequence:CCGGCACAAGAATCTCTTGGCGGAACTCGAGTTCCGCCAAGAGATTCTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030218.1-1516s1c1
Sequence:CCGGGTGTGGTGAGATTAGGGAATTCTCGAGAATTCCCTAATCTCACCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030218.1-187s1c1
Sequence:CCGGGCTTGGTACTGGATGAAGATACTCGAGTATCTTCATCCAGTACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030218.1-295s1c1
Sequence:CCGGCCAGACCAGATGTAAAGAGAACTCGAGTTCTCTTTACATCTGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)