EMAIL THIS PAGE TO A FRIEND

MITD1

MIT, microtubule interacting and transport, domain containing 1

71 Gene Product Result for
UniProtKB ID: Q8WV92, Q69YV0
Gene ID:
Mouse(69028) MIT, microtubule interacting and transport, domain containing 1
Rat(363219) MIT, microtubule interacting and transport, domain containing 1
Zebrafish(393170) MIT, microtubule interacting and transport, domain containing 1
dog(474559) MIT, microtubule interacting and transport, domain containing 1
domestic cat(101087394) MIT, microtubule interacting and transport, domain containing 1
cow(504291) MIT, microtubule interacting and transport, domain containing 1
chicken(418698) MIT, microtubule interacting and transport, domain containing 1
domestic guinea pig(100720352) MIT, microtubule interacting and transport, domain containing 1
naked mole-rat(101697441) MIT, microtubule interacting and transport, domain containing 1
sheep(101107510) MIT, microtubule interacting and transport, domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138798 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138798 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138798 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138798 Rosetta Predictions human pricing
NM_001009714 Rosetta Predictions rat pricing
NM_026913 Rosetta Predictions mouse pricing
XM_898897 Rosetta Predictions mouse pricing
XM_898907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363951 predicted 596
2 SASI_Hs01_00027186 predicted 365
3 SASI_Hs01_00027187 predicted 423
4 SASI_Hs01_00027188 predicted 416
5 SASI_Hs01_00027189 predicted 411
6 SASI_Hs01_00027190 predicted 434
7 SASI_Hs01_00027192 predicted 436
8 SASI_Hs01_00027193 predicted 380
9 SASI_Hs01_00027194 predicted 329
10 SASI_Hs01_00027195 predicted 590
11 SASI_Hs01_00027191 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082115 predicted 456
2 SASI_Rn01_00082116 predicted 219
3 SASI_Rn01_00082117 predicted 401
4 SASI_Rn01_00082118 predicted 360
5 SASI_Rn01_00082119 predicted 310
6 SASI_Rn02_00199778 predicted 439
7 SASI_Rn01_00082120 predicted 453
8 SASI_Rn01_00082121 predicted 440
9 SASI_Rn01_00082123 predicted 411
10 SASI_Rn01_00082124 predicted 308
11 SASI_Rn01_00082122 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331183 predicted 464
2 SASI_Mm02_00331184 predicted 924
3 SASI_Mm02_00331185 predicted 466
4 SASI_Mm02_00331186 predicted 490
5 SASI_Mm02_00331187 predicted 397
6 SASI_Mm02_00331188 predicted 472
7 SASI_Mm02_00331189 predicted 388
8 SASI_Mm02_00331190 predicted 764
9 SASI_Mm02_00331191 predicted 447
10 SASI_Mm02_00331192 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217064 predicted 823
2 SASI_Mm01_00217065 predicted 534
3 SASI_Mm01_00217066 predicted 831
4 SASI_Mm01_00217067 predicted 781
5 SASI_Mm01_00217068 predicted 753
6 SASI_Mm01_00217069 predicted 512
7 SASI_Mm01_00217070 predicted 425
8 SASI_Mm01_00217071 predicted 409
9 SASI_Mm01_00217072 predicted 680
10 SASI_Mm01_00217073 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202788 predicted 508
2 SASI_Mm01_00202789 predicted 492
3 SASI_Mm01_00202790 predicted 560
4 SASI_Mm01_00202791 predicted 492
5 SASI_Mm01_00202792 predicted 493
6 SASI_Mm01_00202793 predicted 513
7 SASI_Mm01_00202794 predicted 427
8 SASI_Mm01_00202795 predicted 433
9 SASI_Mm01_00202796 predicted 501
10 SASI_Mm01_00202797 predicted 413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138798
VALIDATED
MITD1 MISSION shRNA Bacterial Glycerol Stock
MIT, microtubule interacting and transport, domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138798.1-113s1c1
Sequence:CCGGCAGTAGAACTAGATTCGGAGTCTCGAGACTCCGAATCTAGTTCTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138798.1-347s1c1
Sequence:CCGGGTTTCAGTTATGAGTCACTTTCTCGAGAAAGTGACTCATAACTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138798.1-438s1c1
Sequence:CCGGGCTGTATAACTTTCTTCGATTCTCGAGAATCGAAGAAAGTTATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138798.1-645s1c1
Sequence:CCGGCAACAATGGATGGATGATTAACTCGAGTTAATCATCCATCCATTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138798.1-468s1c1
Sequence:CCGGGCTTATTAAGAGACCATGTAACTCGAGTTACATGGTCTCTTAATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138798.1-400s1c1
Sequence:CCGGGTTTGGATAGAAGATCCTTATCTCGAGATAAGGATCTTCTATCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138798.1-186s1c1
Sequence:CCGGGCAGGTTCTGAAAGGTACCAACTCGAGTTGGTACCTTTCAGAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138798
VALIDATED
MITD1 MISSION shRNA shRNA Plasmid DNA
MIT, microtubule interacting and transport, domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138798.1-113s1c1
Sequence:CCGGCAGTAGAACTAGATTCGGAGTCTCGAGACTCCGAATCTAGTTCTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138798.1-347s1c1
Sequence:CCGGGTTTCAGTTATGAGTCACTTTCTCGAGAAAGTGACTCATAACTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138798.1-438s1c1
Sequence:CCGGGCTGTATAACTTTCTTCGATTCTCGAGAATCGAAGAAAGTTATACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138798.1-645s1c1
Sequence:CCGGCAACAATGGATGGATGATTAACTCGAGTTAATCATCCATCCATTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138798.1-468s1c1
Sequence:CCGGGCTTATTAAGAGACCATGTAACTCGAGTTACATGGTCTCTTAATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138798.1-400s1c1
Sequence:CCGGGTTTGGATAGAAGATCCTTATCTCGAGATAAGGATCTTCTATCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138798.1-186s1c1
Sequence:CCGGGCAGGTTCTGAAAGGTACCAACTCGAGTTGGTACCTTTCAGAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138798
VALIDATED
MITD1 MISSION shRNA Lentiviral Transduction Particles
MIT, microtubule interacting and transport, domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138798.1-113s1c1
Sequence:CCGGCAGTAGAACTAGATTCGGAGTCTCGAGACTCCGAATCTAGTTCTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138798.1-347s1c1
Sequence:CCGGGTTTCAGTTATGAGTCACTTTCTCGAGAAAGTGACTCATAACTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138798.1-438s1c1
Sequence:CCGGGCTGTATAACTTTCTTCGATTCTCGAGAATCGAAGAAAGTTATACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138798.1-645s1c1
Sequence:CCGGCAACAATGGATGGATGATTAACTCGAGTTAATCATCCATCCATTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138798.1-468s1c1
Sequence:CCGGGCTTATTAAGAGACCATGTAACTCGAGTTACATGGTCTCTTAATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138798.1-400s1c1
Sequence:CCGGGTTTGGATAGAAGATCCTTATCTCGAGATAAGGATCTTCTATCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138798.1-186s1c1
Sequence:CCGGGCAGGTTCTGAAAGGTACCAACTCGAGTTGGTACCTTTCAGAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026913
MITD1 MISSION shRNA Bacterial Glycerol Stock
MIT, microtubule interacting and transport, domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026913.2-882s21c1
Sequence:CCGGGTAGGTGACCTCAGCCCATTTCTCGAGAAATGGGCTGAGGTCACCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026913.2-522s21c1
Sequence:CCGGCTGATTAAGAAGCCGTGTAAACTCGAGTTTACACGGCTTCTTAATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026913.2-479s21c1
Sequence:CCGGACAAACTCATCAGCTCTATAACTCGAGTTATAGAGCTGATGAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026913.2-456s21c1
Sequence:CCGGTGGATAGAAGACCCTTATATTCTCGAGAATATAAGGGTCTTCTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026913.2-673s21c1
Sequence:CCGGCTATACATGACCGAGAAATTACTCGAGTAATTTCTCGGTCATGTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026913
MITD1 MISSION shRNA shRNA Plasmid DNA
MIT, microtubule interacting and transport, domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026913.2-882s21c1
Sequence:CCGGGTAGGTGACCTCAGCCCATTTCTCGAGAAATGGGCTGAGGTCACCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026913.2-522s21c1
Sequence:CCGGCTGATTAAGAAGCCGTGTAAACTCGAGTTTACACGGCTTCTTAATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026913.2-479s21c1
Sequence:CCGGACAAACTCATCAGCTCTATAACTCGAGTTATAGAGCTGATGAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026913.2-456s21c1
Sequence:CCGGTGGATAGAAGACCCTTATATTCTCGAGAATATAAGGGTCTTCTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026913.2-673s21c1
Sequence:CCGGCTATACATGACCGAGAAATTACTCGAGTAATTTCTCGGTCATGTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026913
MITD1 MISSION shRNA Lentiviral Transduction Particles
MIT, microtubule interacting and transport, domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026913.2-882s21c1
Sequence:CCGGGTAGGTGACCTCAGCCCATTTCTCGAGAAATGGGCTGAGGTCACCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026913.2-522s21c1
Sequence:CCGGCTGATTAAGAAGCCGTGTAAACTCGAGTTTACACGGCTTCTTAATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026913.2-479s21c1
Sequence:CCGGACAAACTCATCAGCTCTATAACTCGAGTTATAGAGCTGATGAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026913.2-456s21c1
Sequence:CCGGTGGATAGAAGACCCTTATATTCTCGAGAATATAAGGGTCTTCTATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026913.2-673s21c1
Sequence:CCGGCTATACATGACCGAGAAATTACTCGAGTAATTTCTCGGTCATGTATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)