EMAIL THIS PAGE TO A FRIEND

MIXL1

Mix paired-like homeobox

46 Gene Product Result for
Synonyms: MILD1 MIX MIXL
UniProtKB ID: Q9H2W2
Gene ID:
Human(83881) Summary: Homeodomain proteins, such as MIXL1, are transcription factors that regulate cell fate during development (Hart et al., 2005 [PubMed 15982639]
Mouse(27217) Mix1 homeobox-like 1 (Xenopus laevis)
Rat(289311) Mix paired-like homeobox 1
chicken(395838) Mix paired-like homeobox
cow(614854) Mix paired-like homeobox
domestic guinea pig(101787529) Mix paired-like homeobox
naked mole-rat(101702490) Mix paired-like homeobox
sheep(101105839) Mix paired-like homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031944 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031944 Rosetta Predictions human pricing
NM_001105979 Rosetta Predictions rat pricing
NM_013729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157002 predicted 452
2 SASI_Hs02_00359098 predicted 470
3 SASI_Hs01_00157003 predicted 450
4 SASI_Hs01_00157005 predicted 473
5 SASI_Hs01_00157007 predicted 468
6 SASI_Hs01_00157008 predicted 416
7 SASI_Hs01_00157009 predicted 404
8 SASI_Hs01_00157010 predicted 408
9 SASI_Hs02_00359099 predicted 413
10 SASI_Hs02_00359100 predicted 427
11 SASI_Hs01_00157001 predicted 463
12 SASI_Hs01_00157004 predicted 420
13 SASI_Hs01_00157006 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214432 predicted 643
2 SASI_Rn02_00214433 predicted 570
3 SASI_Rn02_00214434 predicted 842
4 SASI_Rn02_00214435 predicted 520
5 SASI_Rn02_00214436 predicted 661
6 SASI_Rn02_00214437 predicted 629
7 SASI_Rn02_00214438 predicted 747
8 SASI_Rn02_00214439 predicted 802
9 SASI_Rn02_00214440 predicted 760
10 SASI_Rn02_00214441 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115875 predicted 824
2 SASI_Mm01_00115876 predicted 889
3 SASI_Mm01_00115877 predicted 630
4 SASI_Mm01_00115878 predicted 957
5 SASI_Mm01_00115879 predicted 931
6 SASI_Mm01_00115880 predicted 837
7 SASI_Mm01_00115881 predicted 338
8 SASI_Mm01_00115882 predicted 525
9 SASI_Mm01_00115883 predicted 984
10 SASI_Mm01_00115884 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031944
MIXL1 MISSION shRNA Bacterial Glycerol Stock
Mix paired-like homeobox
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031944.1-390s21c1
Sequence:CCGGCCAGGTATGGTTCCAGAACAGCTCGAGCTGTTCTGGAACCATACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031944.1-462s21c1
Sequence:CCGGGCCGGAGATTATCCTCAACCACTCGAGTGGTTGAGGATAATCTCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031944.1-426s1c1
Sequence:CCGGGCGTCAGAGTGGGAAATCCTTCTCGAGAAGGATTTCCCACTCTGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031944.1-487s1c1
Sequence:CCGGGCTCCTGGAACTGAAACGAAACTCGAGTTTCGTTTCAGTTCCAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031944.1-144s1c1
Sequence:CCGGCCCAGCGACCTTTGCGGGCTTCTCGAGAAGCCCGCAAAGGTCGCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031944.1-268s1c1
Sequence:CCGGCGCACGTCTTTCAGCGCCGAACTCGAGTTCGGCGCTGAAAGACGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031944.1-435s21c1
Sequence:CCGGTGGGAAATCCTTCCAACCTTTCTCGAGAAAGGTTGGAAGGATTTCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031944.1-382s21c1
Sequence:CCGGTCCAGGATCCAGGTATGGTTCCTCGAGGAACCATACCTGGATCCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031944.1-525s1c1
Sequence:CCGGGCCTCTTGAGGTAGATGTGAACTCGAGTTCACATCTACCTCAAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031944
MIXL1 MISSION shRNA shRNA Plasmid DNA
Mix paired-like homeobox
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031944.1-390s21c1
Sequence:CCGGCCAGGTATGGTTCCAGAACAGCTCGAGCTGTTCTGGAACCATACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031944.1-462s21c1
Sequence:CCGGGCCGGAGATTATCCTCAACCACTCGAGTGGTTGAGGATAATCTCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031944.1-426s1c1
Sequence:CCGGGCGTCAGAGTGGGAAATCCTTCTCGAGAAGGATTTCCCACTCTGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031944.1-487s1c1
Sequence:CCGGGCTCCTGGAACTGAAACGAAACTCGAGTTTCGTTTCAGTTCCAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031944.1-144s1c1
Sequence:CCGGCCCAGCGACCTTTGCGGGCTTCTCGAGAAGCCCGCAAAGGTCGCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031944.1-268s1c1
Sequence:CCGGCGCACGTCTTTCAGCGCCGAACTCGAGTTCGGCGCTGAAAGACGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031944.1-435s21c1
Sequence:CCGGTGGGAAATCCTTCCAACCTTTCTCGAGAAAGGTTGGAAGGATTTCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031944.1-382s21c1
Sequence:CCGGTCCAGGATCCAGGTATGGTTCCTCGAGGAACCATACCTGGATCCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031944.1-525s1c1
Sequence:CCGGGCCTCTTGAGGTAGATGTGAACTCGAGTTCACATCTACCTCAAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031944
MIXL1 MISSION shRNA Lentiviral Transduction Particles
Mix paired-like homeobox
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031944.1-390s21c1
Sequence:CCGGCCAGGTATGGTTCCAGAACAGCTCGAGCTGTTCTGGAACCATACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031944.1-462s21c1
Sequence:CCGGGCCGGAGATTATCCTCAACCACTCGAGTGGTTGAGGATAATCTCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031944.1-426s1c1
Sequence:CCGGGCGTCAGAGTGGGAAATCCTTCTCGAGAAGGATTTCCCACTCTGACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031944.1-487s1c1
Sequence:CCGGGCTCCTGGAACTGAAACGAAACTCGAGTTTCGTTTCAGTTCCAGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031944.1-144s1c1
Sequence:CCGGCCCAGCGACCTTTGCGGGCTTCTCGAGAAGCCCGCAAAGGTCGCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031944.1-268s1c1
Sequence:CCGGCGCACGTCTTTCAGCGCCGAACTCGAGTTCGGCGCTGAAAGACGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031944.1-435s21c1
Sequence:CCGGTGGGAAATCCTTCCAACCTTTCTCGAGAAAGGTTGGAAGGATTTCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031944.1-382s21c1
Sequence:CCGGTCCAGGATCCAGGTATGGTTCCTCGAGGAACCATACCTGGATCCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031944.1-525s1c1
Sequence:CCGGGCCTCTTGAGGTAGATGTGAACTCGAGTTCACATCTACCTCAAGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013729
MIXL1 MISSION shRNA Bacterial Glycerol Stock
Mix paired-like homeobox
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013729.3-1191s21c1
Sequence:CCGGTCCTGTCCTCCTAGCTTTATTCTCGAGAATAAAGCTAGGAGGACAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013729.3-890s21c1
Sequence:CCGGTCTCCAAGACTGCACATTATACTCGAGTATAATGTGCAGTCTTGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013729.2-516s1c1
Sequence:CCGGCTGGGACTGAAGCTAGGTGTTCTCGAGAACACCTAGCTTCAGTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013729.2-172s1c1
Sequence:CCGGAGCCACGCAGTGCTTTCCAAACTCGAGTTTGGAAAGCACTGCGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013729.2-649s1c1
Sequence:CCGGCTCTGAAGATATTGGCTCAAACTCGAGTTTGAGCCAATATCTTCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013729.2-457s1c1
Sequence:CCGGTGGGAAGTCATTTCAGCCCTTCTCGAGAAGGGCTGAAATGACTTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013729.2-328s1c1
Sequence:CCGGGCTCGTCTTCCGACAGACCATCTCGAGATGGTCTGTCGGAAGACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013729.3-931s21c1
Sequence:CCGGGCCTTCTTACTAGGGTTATTCCTCGAGGAATAACCCTAGTAAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013729
MIXL1 MISSION shRNA shRNA Plasmid DNA
Mix paired-like homeobox
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013729.3-1191s21c1
Sequence:CCGGTCCTGTCCTCCTAGCTTTATTCTCGAGAATAAAGCTAGGAGGACAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013729.3-890s21c1
Sequence:CCGGTCTCCAAGACTGCACATTATACTCGAGTATAATGTGCAGTCTTGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013729.2-516s1c1
Sequence:CCGGCTGGGACTGAAGCTAGGTGTTCTCGAGAACACCTAGCTTCAGTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013729.2-172s1c1
Sequence:CCGGAGCCACGCAGTGCTTTCCAAACTCGAGTTTGGAAAGCACTGCGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013729.2-649s1c1
Sequence:CCGGCTCTGAAGATATTGGCTCAAACTCGAGTTTGAGCCAATATCTTCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013729.2-457s1c1
Sequence:CCGGTGGGAAGTCATTTCAGCCCTTCTCGAGAAGGGCTGAAATGACTTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013729.2-328s1c1
Sequence:CCGGGCTCGTCTTCCGACAGACCATCTCGAGATGGTCTGTCGGAAGACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013729.3-931s21c1
Sequence:CCGGGCCTTCTTACTAGGGTTATTCCTCGAGGAATAACCCTAGTAAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013729
MIXL1 MISSION shRNA Lentiviral Transduction Particles
Mix paired-like homeobox
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013729.3-1191s21c1
Sequence:CCGGTCCTGTCCTCCTAGCTTTATTCTCGAGAATAAAGCTAGGAGGACAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013729.3-890s21c1
Sequence:CCGGTCTCCAAGACTGCACATTATACTCGAGTATAATGTGCAGTCTTGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013729.2-516s1c1
Sequence:CCGGCTGGGACTGAAGCTAGGTGTTCTCGAGAACACCTAGCTTCAGTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013729.2-172s1c1
Sequence:CCGGAGCCACGCAGTGCTTTCCAAACTCGAGTTTGGAAAGCACTGCGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013729.2-649s1c1
Sequence:CCGGCTCTGAAGATATTGGCTCAAACTCGAGTTTGAGCCAATATCTTCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013729.2-457s1c1
Sequence:CCGGTGGGAAGTCATTTCAGCCCTTCTCGAGAAGGGCTGAAATGACTTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013729.2-328s1c1
Sequence:CCGGGCTCGTCTTCCGACAGACCATCTCGAGATGGTCTGTCGGAAGACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013729.3-931s21c1
Sequence:CCGGGCCTTCTTACTAGGGTTATTCCTCGAGGAATAACCCTAGTAAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)