EMAIL THIS PAGE TO A FRIEND

MKI67

antigen identified by monoclonal antibody Ki-67

90 Gene Product Result for
Synonyms: KIA MIB-1
UniProtKB ID: P46013, Q5VWH2
Gene ID:
Human(4288) Summary: This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
Mouse(17345) antigen identified by monoclonal antibody Ki 67
Rat(291234) antigen identified by monoclonal antibody Ki-67
chicken(423963) antigen identified by monoclonal antibody Ki-67
Horse(100055048) antigen identified by monoclonal antibody Ki-67
cow(513220) antigen identified by monoclonal antibody Ki-67
domestic cat(101084831) antigen identified by monoclonal antibody Ki-67
dog(100686578) antigen identified by monoclonal antibody Ki-67
domestic guinea pig(100733750) antigen identified by monoclonal antibody Ki-67
naked mole-rat(101715751) antigen identified by monoclonal antibody Ki-67
Domestic Rabbit(100343428) antigen identified by monoclonal antibody Ki-67
sheep(101106643) antigen identified by monoclonal antibody Ki-67
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500134 Anti-KI-67 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP6, tissue culture supernatant human (tested)
immunohistochemistry pricing
SAB5700770 Anti-Ki67 antibody produced in rabbit mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4501880 Anti-KI67 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry pricing
ZRB1007 Anti-Ki67 Antibody, clone 1O15, ZooMAb® Rabbit Monoclonal recombinant, expressed in HEK 293 cells Antibody Enhanced Validation Green Alternative human
immunocytochemistry, immunohistochemistry, western blot pricing
HPA000451 Anti-MKI67 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
HPA001164 Anti-MKI67 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
WH0004288M1 Monoclonal Anti-MKI67 antibody produced in mouse clone 7B8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
AMAB90870 Monoclonal Anti-MKI67 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1234, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB5300423 Monoclonal Anti-MKI67 antibody produced in mouse clone 4A1, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB5300425 Monoclonal Anti-MKI67 antibody produced in mouse clone 8D5, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
P6834 Monoclonal Anti-Proliferating Cell Protein Ki-67 antibody produced in mouse clone PP-67, ascites fluid human
immunohistochemistry, microarray, western blot pricing
PLA0228 Rabbit anti-Ki-67 IHC Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002417 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081117 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081117 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081117 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002417 Rosetta Predictions human pricing
XM_001056221 Rosetta Predictions rat pricing
XM_225460 Rosetta Predictions rat pricing
NM_001081117 Rosetta Predictions mouse pricing
XM_001000692 Rosetta Predictions mouse pricing
XM_001479849 Rosetta Predictions mouse pricing
XM_133912 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148916 predicted 1910
2 SASI_Hs01_00148917 predicted 2862
3 SASI_Hs01_00148919 predicted 1663
4 SASI_Hs02_00333806 predicted 1490
5 SASI_Hs01_00148920 predicted 9017
6 SASI_Hs01_00148921 predicted 1476
7 SASI_Hs01_00148923 predicted 3279
8 SASI_Hs01_00148924 predicted 1541
9 SASI_Hs02_00333807 predicted 2480
10 SASI_Hs02_00333808 predicted 9643
11 SASI_Hs01_00148915 predicted 4674
12 SASI_Hs01_00148918 predicted 2487
13 SASI_Hs01_00148922 predicted 10234
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282488 predicted 3327
2 SASI_Rn02_00282489 predicted 2941
3 SASI_Rn02_00282490 predicted 3700
4 SASI_Rn02_00282491 predicted 4088
5 SASI_Rn02_00282492 predicted 3481
6 SASI_Rn02_00282493 predicted 1825
7 SASI_Rn02_00282494 predicted 3406
8 SASI_Rn02_00282495 predicted 3232
9 SASI_Rn02_00282496 predicted 3810
10 SASI_Rn02_00282497 predicted 3632
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225460 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382841 predicted 7631
2 SASI_Rn02_00382842 predicted 2047
3 SASI_Rn02_00382843 predicted 859
4 SASI_Rn02_00382844 predicted 2129
5 SASI_Rn02_00382845 predicted 1663
6 SASI_Rn02_00382846 predicted 7241
7 SASI_Rn02_00382847 predicted 8391
8 SASI_Rn02_00382848 predicted 2775
9 SASI_Rn02_00382849 predicted 7775
10 SASI_Rn02_00382850 predicted 6119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295351 predicted 8867
2 SASI_Mm02_00295352 predicted 1577
3 SASI_Mm02_00295353 predicted 7091
4 SASI_Mm02_00295354 predicted 1230
5 SASI_Mm02_00295355 predicted 4800
6 SASI_Mm02_00295356 predicted 4821
7 SASI_Mm02_00295357 predicted 9664
8 SASI_Mm02_00295358 predicted 2416
9 SASI_Mm02_00295359 predicted 1212
10 SASI_Mm02_00295360 predicted 2361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00354770 predicted 8664
2 SASI_Mm02_00354771 predicted 1376
3 SASI_Mm02_00354772 predicted 6893
4 SASI_Mm02_00354773 predicted 1022
5 SASI_Mm02_00354774 predicted 4601
6 SASI_Mm02_00354775 predicted 4628
7 SASI_Mm02_00354776 predicted 9465
8 SASI_Mm02_00354777 predicted 2207
9 SASI_Mm02_00354778 predicted 1009
10 SASI_Mm02_00354779 predicted 2167
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00413136 predicted 8907
2 SASI_Mm02_00413137 predicted 7998
3 SASI_Mm02_00413138 predicted 8264
4 SASI_Mm02_00413139 predicted 8389
5 SASI_Mm02_00413140 predicted 9705
6 SASI_Mm02_00413141 predicted 8763
7 SASI_Mm02_00413142 predicted 8056
8 SASI_Mm02_00413143 predicted 8165
9 SASI_Mm02_00413144 predicted 8277
10 SASI_Mm02_00413145 predicted 7944
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242522 predicted 8186
2 SASI_Mm01_00242523 predicted 7273
3 SASI_Mm01_00242524 predicted 7544
4 SASI_Mm01_00242525 predicted 7667
5 SASI_Mm01_00242526 predicted 8990
6 SASI_Mm01_00242527 predicted 7343
7 SASI_Mm01_00242528 predicted 7450
8 SASI_Mm01_00242529 predicted 7555
9 SASI_Mm01_00242530 predicted 7713
10 SASI_Mm01_00242531 predicted 7228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002417
VALIDATED
MKI67 MISSION shRNA Bacterial Glycerol Stock
antigen identified by monoclonal antibody Ki-67
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002417.4-12011s21c1
Sequence:CCGGCCCATTAAATACAAGCTGTTTCTCGAGAAACAGCTTGTATTTAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002417.2-5637s1c1
Sequence:CCGGGCAGCAATAGACGGCTACAAACTCGAGTTTGTAGCCGTCTATTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002417.2-819s1c1
Sequence:CCGGGCGTTAAATTAGTGAGCCGTTCTCGAGAACGGCTCACTAATTTAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002417.2-2091s1c1
Sequence:CCGGGCCGAAGTCAACATGATATTTCTCGAGAAATATCATGTTGACTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002417.2-9731s1c1
Sequence:CCGGGCGAAGGTTCTCATGCAGAATCTCGAGATTCTGCATGAGAACCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002417.2-12012s1c1
Sequence:CCGGCCCATTAAATACAAGCTGTTTCTCGAGAAACAGCTTGTATTTAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002417.4-818s21c1
Sequence:CCGGGCGTTAAATTAGTGAGCCGTTCTCGAGAACGGCTCACTAATTTAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002417.4-5636s21c1
Sequence:CCGGGCAGCAATAGACGGCTACAAACTCGAGTTTGTAGCCGTCTATTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002417.4-2090s21c1
Sequence:CCGGGCCGAAGTCAACATGATATTTCTCGAGAAATATCATGTTGACTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002417.4-9730s21c1
Sequence:CCGGGCGAAGGTTCTCATGCAGAATCTCGAGATTCTGCATGAGAACCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002417
VALIDATED
MKI67 MISSION shRNA shRNA Plasmid DNA
antigen identified by monoclonal antibody Ki-67
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002417.4-12011s21c1
Sequence:CCGGCCCATTAAATACAAGCTGTTTCTCGAGAAACAGCTTGTATTTAATGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000117958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002417.2-5637s1c1
Sequence:CCGGGCAGCAATAGACGGCTACAAACTCGAGTTTGTAGCCGTCTATTGCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000117959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002417.2-819s1c1
Sequence:CCGGGCGTTAAATTAGTGAGCCGTTCTCGAGAACGGCTCACTAATTTAACGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000117961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002417.2-2091s1c1
Sequence:CCGGGCCGAAGTCAACATGATATTTCTCGAGAAATATCATGTTGACTTCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000117960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002417.2-9731s1c1
Sequence:CCGGGCGAAGGTTCTCATGCAGAATCTCGAGATTCTGCATGAGAACCTTCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000117957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002417.2-12012s1c1
Sequence:CCGGCCCATTAAATACAAGCTGTTTCTCGAGAAACAGCTTGTATTTAATGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000349135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002417.4-818s21c1
Sequence:CCGGGCGTTAAATTAGTGAGCCGTTCTCGAGAACGGCTCACTAATTTAACGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000315834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002417.4-5636s21c1
Sequence:CCGGGCAGCAATAGACGGCTACAAACTCGAGTTTGTAGCCGTCTATTGCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000315838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002417.4-2090s21c1
Sequence:CCGGGCCGAAGTCAACATGATATTTCTCGAGAAATATCATGTTGACTTCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000315833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002417.4-9730s21c1
Sequence:CCGGGCGAAGGTTCTCATGCAGAATCTCGAGATTCTGCATGAGAACCTTCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002417
VALIDATED
MKI67 MISSION shRNA Lentiviral Transduction Particles
antigen identified by monoclonal antibody Ki-67
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000315835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002417.4-12011s21c1
Sequence:CCGGCCCATTAAATACAAGCTGTTTCTCGAGAAACAGCTTGTATTTAATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002417.2-5637s1c1
Sequence:CCGGGCAGCAATAGACGGCTACAAACTCGAGTTTGTAGCCGTCTATTGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002417.2-819s1c1
Sequence:CCGGGCGTTAAATTAGTGAGCCGTTCTCGAGAACGGCTCACTAATTTAACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002417.2-2091s1c1
Sequence:CCGGGCCGAAGTCAACATGATATTTCTCGAGAAATATCATGTTGACTTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002417.2-9731s1c1
Sequence:CCGGGCGAAGGTTCTCATGCAGAATCTCGAGATTCTGCATGAGAACCTTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002417.2-12012s1c1
Sequence:CCGGCCCATTAAATACAAGCTGTTTCTCGAGAAACAGCTTGTATTTAATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002417.4-818s21c1
Sequence:CCGGGCGTTAAATTAGTGAGCCGTTCTCGAGAACGGCTCACTAATTTAACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002417.4-5636s21c1
Sequence:CCGGGCAGCAATAGACGGCTACAAACTCGAGTTTGTAGCCGTCTATTGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002417.4-2090s21c1
Sequence:CCGGGCCGAAGTCAACATGATATTTCTCGAGAAATATCATGTTGACTTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002417.4-9730s21c1
Sequence:CCGGGCGAAGGTTCTCATGCAGAATCTCGAGATTCTGCATGAGAACCTTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081117
VALIDATED
MKI67 MISSION shRNA Bacterial Glycerol Stock
antigen identified by monoclonal antibody Ki-67
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081117.2-9802s21c1
Sequence:CCGGCTATGTAGCAAAGACATTTAACTCGAGTTAAATGTCTTTGCTACATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081117.2-4688s21c1
Sequence:CCGGGACAGTCTAGGGCAAGTATAACTCGAGTTATACTTGCCCTAGACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081117.2-1557s21c1
Sequence:CCGGTGGTCTTAGTTCCGTTGATATCTCGAGATATCAACGGAACTAAGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081117.2-5298s21c1
Sequence:CCGGCTACTGTTCTGATCCATTAATCTCGAGATTAATGGATCAGAACAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081117.2-5718s21c1
Sequence:GTACCGGACAACCAGGACATATCATAAACTCGAGTTTATGATATGTCCTGGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081117
VALIDATED
MKI67 MISSION shRNA shRNA Plasmid DNA
antigen identified by monoclonal antibody Ki-67
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081117.2-9802s21c1
Sequence:CCGGCTATGTAGCAAAGACATTTAACTCGAGTTAAATGTCTTTGCTACATAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000238590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081117.2-4688s21c1
Sequence:CCGGGACAGTCTAGGGCAAGTATAACTCGAGTTATACTTGCCCTAGACTGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000238589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081117.2-1557s21c1
Sequence:CCGGTGGTCTTAGTTCCGTTGATATCTCGAGATATCAACGGAACTAAGACCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000238591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081117.2-5298s21c1
Sequence:CCGGCTACTGTTCTGATCCATTAATCTCGAGATTAATGGATCAGAACAGTAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000218038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081117.2-5718s21c1
Sequence:GTACCGGACAACCAGGACATATCATAAACTCGAGTTTATGATATGTCCTGGTTGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081117
VALIDATED
MKI67 MISSION shRNA Lentiviral Transduction Particles
antigen identified by monoclonal antibody Ki-67
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000238588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081117.2-9802s21c1
Sequence:CCGGCTATGTAGCAAAGACATTTAACTCGAGTTAAATGTCTTTGCTACATAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081117.2-4688s21c1
Sequence:CCGGGACAGTCTAGGGCAAGTATAACTCGAGTTATACTTGCCCTAGACTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081117.2-1557s21c1
Sequence:CCGGTGGTCTTAGTTCCGTTGATATCTCGAGATATCAACGGAACTAAGACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081117.2-5298s21c1
Sequence:CCGGCTACTGTTCTGATCCATTAATCTCGAGATTAATGGATCAGAACAGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081117.2-5718s21c1
Sequence:GTACCGGACAACCAGGACATATCATAAACTCGAGTTTATGATATGTCCTGGTTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)