EMAIL THIS PAGE TO A FRIEND

MKI67IP

MKI67 (FHA domain) interacting nucleolar phosphoprotein

71 Gene Product Result for
Synonyms: NIFK Nopp34
UniProtKB ID: Q9BYG3, A8K788, Q8TB66, Q96ED4
Gene ID:
Human(84365) Summary: This gene encodes a protein that interacts with the forkhead-associated domain of the Ki-67 antigen. The encoded protein may bind RNA and may play a role in mitosis and cell cycle progression. Multiple pseudogenes exist on chromosomes 5, 10, 12, 15, and 19.[provided by RefSeq, Jan 2009]
Mouse(67949) Mki67 (FHA domain) interacting nucleolar phosphoprotein
Rat(246042) Mki67 (FHA domain) interacting nucleolar phosphoprotein
sheep(101115762) MKI67 (FHA domain) interacting nucleolar phosphoprotein
naked mole-rat(101722926) MKI67 (FHA domain) interacting nucleolar phosphoprotein
domestic guinea pig(100716123) MKI67 (FHA domain) interacting nucleolar phosphoprotein
Zebrafish(317644) mki67 (FHA domain) interacting nucleolar phosphoprotein (human)
cow(509598) MKI67 (FHA domain) interacting nucleolar phosphoprotein
domestic cat(101100654) MKI67 (FHA domain) interacting nucleolar phosphoprotein
dog(476111) MKI67 (FHA domain) interacting nucleolar phosphoprotein
chicken(424239) MKI67 (FHA domain) interacting nucleolar phosphoprotein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032390 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032390 Rosetta Predictions human pricing
NM_139186 Rosetta Predictions rat pricing
XM_579665 Rosetta Predictions rat pricing
NM_026472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154181 predicted 470
2 SASI_Hs01_00154182 predicted 1360
3 SASI_Hs01_00154183 predicted 1389
4 SASI_Hs01_00154184 predicted 1331
5 SASI_Hs01_00154185 predicted 1222
6 SASI_Hs01_00154186 predicted 445
7 SASI_Hs01_00154187 predicted 544
8 SASI_Hs01_00154188 predicted 447
9 SASI_Hs01_00154189 predicted 1280
10 SASI_Hs01_00154190 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268510 predicted 696
2 SASI_Rn02_00268511 predicted 229
3 SASI_Rn02_00268512 predicted 370
4 SASI_Rn02_00268513 predicted 608
5 SASI_Rn02_00268514 predicted 334
6 SASI_Rn02_00268515 predicted 376
7 SASI_Rn02_00268516 predicted 860
8 SASI_Rn02_00268517 predicted 541
9 SASI_Rn02_00268518 predicted 552
10 SASI_Rn02_00268519 predicted 668
11 SASI_Rn01_00033551 predicted 756
12 SASI_Rn01_00033552 predicted 596
13 SASI_Rn01_00033553 predicted 768
14 SASI_Rn01_00033554 predicted 573
15 SASI_Rn01_00033555 predicted 605
16 SASI_Rn01_00033556 predicted 624
17 SASI_Rn01_00033557 predicted 571
18 SASI_Rn01_00033558 predicted 636
19 SASI_Rn01_00033559 predicted 730
20 SASI_Rn01_00033560 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150778 predicted 606
2 SASI_Rn01_00150779 predicted 605
3 SASI_Rn01_00150780 predicted 597
4 SASI_Rn01_00150781 predicted 476
5 SASI_Rn01_00150782 predicted 603
6 SASI_Rn01_00150783 predicted 483
7 SASI_Rn01_00150784 predicted 483
8 SASI_Rn01_00150785 predicted 568
9 SASI_Rn01_00150786 predicted 487
10 SASI_Rn01_00150787 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158666 predicted 990
2 SASI_Mm01_00158667 predicted 734
3 SASI_Mm01_00158668 predicted 614
4 SASI_Mm01_00158669 predicted 248
5 SASI_Mm01_00158670 predicted 355
6 SASI_Mm01_00158671 predicted 1027
7 SASI_Mm01_00158672 predicted 634
8 SASI_Mm01_00158673 predicted 522
9 SASI_Mm01_00158674 predicted 651
10 SASI_Mm01_00158675 predicted 815
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026472
VALIDATED
MKI67IP MISSION shRNA Bacterial Glycerol Stock
MKI67 (FHA domain) interacting nucleolar phosphoprotein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026472.2-1268s1c1
Sequence:CCGGCGGTGTGTAGTTGTGTATCTACTCGAGTAGATACACAACTACACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026472.2-200s1c1
Sequence:CCGGGCCACCTACCTTCAACACTTTCTCGAGAAAGTGTTGAAGGTAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026472.2-347s1c1
Sequence:CCGGCCAAGATAGTTGCAGAAACAACTCGAGTTGTTTCTGCAACTATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026472.2-257s1c1
Sequence:CCGGGCGACATTAGCAGATTCAGATCTCGAGATCTGAATCTGCTAATGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026472.2-872s1c1
Sequence:CCGGGTGGCGATAAAGATGATGAAACTCGAGTTTCATCATCTTTATCGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026472.4-486s21c1
Sequence:CCGGCCAGCAGTGAAGCGCTATAATCTCGAGATTATAGCGCTTCACTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026472.4-179s21c1
Sequence:CCGGACTTAACCGTGGAGTAGTTTACTCGAGTAAACTACTCCACGGTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026472.4-1273s21c1
Sequence:CCGGCGGTGTGTAGTTGTGTATCTACTCGAGTAGATACACAACTACACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026472.4-205s21c1
Sequence:CCGGGCCACCTACCTTCAACACTTTCTCGAGAAAGTGTTGAAGGTAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026472.4-262s21c1
Sequence:CCGGGCGACATTAGCAGATTCAGATCTCGAGATCTGAATCTGCTAATGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026472
VALIDATED
MKI67IP MISSION shRNA shRNA Plasmid DNA
MKI67 (FHA domain) interacting nucleolar phosphoprotein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026472.2-1268s1c1
Sequence:CCGGCGGTGTGTAGTTGTGTATCTACTCGAGTAGATACACAACTACACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026472.2-200s1c1
Sequence:CCGGGCCACCTACCTTCAACACTTTCTCGAGAAAGTGTTGAAGGTAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026472.2-347s1c1
Sequence:CCGGCCAAGATAGTTGCAGAAACAACTCGAGTTGTTTCTGCAACTATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026472.2-257s1c1
Sequence:CCGGGCGACATTAGCAGATTCAGATCTCGAGATCTGAATCTGCTAATGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026472.2-872s1c1
Sequence:CCGGGTGGCGATAAAGATGATGAAACTCGAGTTTCATCATCTTTATCGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026472.4-486s21c1
Sequence:CCGGCCAGCAGTGAAGCGCTATAATCTCGAGATTATAGCGCTTCACTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026472.4-179s21c1
Sequence:CCGGACTTAACCGTGGAGTAGTTTACTCGAGTAAACTACTCCACGGTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026472.4-1273s21c1
Sequence:CCGGCGGTGTGTAGTTGTGTATCTACTCGAGTAGATACACAACTACACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026472.4-205s21c1
Sequence:CCGGGCCACCTACCTTCAACACTTTCTCGAGAAAGTGTTGAAGGTAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026472.4-262s21c1
Sequence:CCGGGCGACATTAGCAGATTCAGATCTCGAGATCTGAATCTGCTAATGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026472
VALIDATED
MKI67IP MISSION shRNA Lentiviral Transduction Particles
MKI67 (FHA domain) interacting nucleolar phosphoprotein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026472.2-1268s1c1
Sequence:CCGGCGGTGTGTAGTTGTGTATCTACTCGAGTAGATACACAACTACACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026472.2-200s1c1
Sequence:CCGGGCCACCTACCTTCAACACTTTCTCGAGAAAGTGTTGAAGGTAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026472.2-347s1c1
Sequence:CCGGCCAAGATAGTTGCAGAAACAACTCGAGTTGTTTCTGCAACTATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026472.2-257s1c1
Sequence:CCGGGCGACATTAGCAGATTCAGATCTCGAGATCTGAATCTGCTAATGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026472.2-872s1c1
Sequence:CCGGGTGGCGATAAAGATGATGAAACTCGAGTTTCATCATCTTTATCGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026472.4-486s21c1
Sequence:CCGGCCAGCAGTGAAGCGCTATAATCTCGAGATTATAGCGCTTCACTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026472.4-179s21c1
Sequence:CCGGACTTAACCGTGGAGTAGTTTACTCGAGTAAACTACTCCACGGTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026472.4-1273s21c1
Sequence:CCGGCGGTGTGTAGTTGTGTATCTACTCGAGTAGATACACAACTACACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026472.4-205s21c1
Sequence:CCGGGCCACCTACCTTCAACACTTTCTCGAGAAAGTGTTGAAGGTAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026472.4-262s21c1
Sequence:CCGGGCGACATTAGCAGATTCAGATCTCGAGATCTGAATCTGCTAATGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032390
MKI67IP MISSION shRNA Bacterial Glycerol Stock
MKI67 (FHA domain) interacting nucleolar phosphoprotein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032390.3-471s1c1
Sequence:CCGGTCAATCAGTGAAACGGTATAACTCGAGTTATACCGTTTCACTGATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032390.3-520s1c1
Sequence:CCGGCGGATGGAGGAGCGATTTAAACTCGAGTTTAAATCGCTCCTCCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032390.3-451s1c1
Sequence:CCGGCCATTTAAGCAGCCATCATATCTCGAGATATGATGGCTGCTTAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032390.3-1266s1c1
Sequence:CCGGCCAGCAATTAAAGACCACCAACTCGAGTTGGTGGTCTTTAATTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032390.3-192s1c1
Sequence:CCGGCCACCTACCTAACCTACTTGACTCGAGTCAAGTAGGTTAGGTAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032390.4-508s21c1
Sequence:CCGGCATCAGTGAAACGGTATAATCCTCGAGGATTATACCGTTTCACTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032390.4-124s21c1
Sequence:CCGGCGCAGGAAGATGTCGAGTTTCCTCGAGGAAACTCGACATCTTCCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032390.4-780s21c1
Sequence:CCGGCCAGTTTGTACACCAACATTTCTCGAGAAATGTTGGTGTACAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032390.4-1262s21c1
Sequence:CCGGACTGCAGGTTTAAGTACTAAACTCGAGTTTAGTACTTAAACCTGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032390
MKI67IP MISSION shRNA shRNA Plasmid DNA
MKI67 (FHA domain) interacting nucleolar phosphoprotein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032390.3-471s1c1
Sequence:CCGGTCAATCAGTGAAACGGTATAACTCGAGTTATACCGTTTCACTGATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032390.3-520s1c1
Sequence:CCGGCGGATGGAGGAGCGATTTAAACTCGAGTTTAAATCGCTCCTCCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032390.3-451s1c1
Sequence:CCGGCCATTTAAGCAGCCATCATATCTCGAGATATGATGGCTGCTTAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032390.3-1266s1c1
Sequence:CCGGCCAGCAATTAAAGACCACCAACTCGAGTTGGTGGTCTTTAATTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032390.3-192s1c1
Sequence:CCGGCCACCTACCTAACCTACTTGACTCGAGTCAAGTAGGTTAGGTAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032390.4-508s21c1
Sequence:CCGGCATCAGTGAAACGGTATAATCCTCGAGGATTATACCGTTTCACTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032390.4-124s21c1
Sequence:CCGGCGCAGGAAGATGTCGAGTTTCCTCGAGGAAACTCGACATCTTCCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032390.4-780s21c1
Sequence:CCGGCCAGTTTGTACACCAACATTTCTCGAGAAATGTTGGTGTACAAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032390.4-1262s21c1
Sequence:CCGGACTGCAGGTTTAAGTACTAAACTCGAGTTTAGTACTTAAACCTGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032390
MKI67IP MISSION shRNA Lentiviral Transduction Particles
MKI67 (FHA domain) interacting nucleolar phosphoprotein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032390.3-471s1c1
Sequence:CCGGTCAATCAGTGAAACGGTATAACTCGAGTTATACCGTTTCACTGATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032390.3-520s1c1
Sequence:CCGGCGGATGGAGGAGCGATTTAAACTCGAGTTTAAATCGCTCCTCCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032390.3-451s1c1
Sequence:CCGGCCATTTAAGCAGCCATCATATCTCGAGATATGATGGCTGCTTAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032390.3-1266s1c1
Sequence:CCGGCCAGCAATTAAAGACCACCAACTCGAGTTGGTGGTCTTTAATTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032390.3-192s1c1
Sequence:CCGGCCACCTACCTAACCTACTTGACTCGAGTCAAGTAGGTTAGGTAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032390.4-508s21c1
Sequence:CCGGCATCAGTGAAACGGTATAATCCTCGAGGATTATACCGTTTCACTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032390.4-124s21c1
Sequence:CCGGCGCAGGAAGATGTCGAGTTTCCTCGAGGAAACTCGACATCTTCCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032390.4-780s21c1
Sequence:CCGGCCAGTTTGTACACCAACATTTCTCGAGAAATGTTGGTGTACAAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032390.4-1262s21c1
Sequence:CCGGACTGCAGGTTTAAGTACTAAACTCGAGTTTAGTACTTAAACCTGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)