EMAIL THIS PAGE TO A FRIEND

MKL1

megakaryoblastic leukemia (translocation) 1

71 Gene Product Result for
Synonyms: BSAC MAL MRTF-A
UniProtKB ID: Q969V6, Q8TCL1, Q96SC5, Q96SC6, Q9P2B0
Gene ID:
Human(57591) Summary: The protein encoded by this gene interacts with the transcription factor myocardin, a key regulator of smooth muscle cell differentiation. The encoded protein is predominantly nuclear and may help transduce signals from the cytoskeleton to the nucleus. This gene is involved in a specific translocation event that creates a fusion of this gene and the RNA-binding motif protein-15 gene. This translocation has been associated with acute megakaryocytic leukemia. [provided by RefSeq, Jul 2008]
Mouse(223701) MKL (megakaryoblastic leukemia)/myocardin-like 1
Rat(315151) megakaryoblastic leukemia (translocation) 1
sheep(101102638) megakaryoblastic leukemia (translocation) 1
naked mole-rat(101718427) megakaryoblastic leukemia (translocation) 1
chicken(418005) megakaryoblastic leukemia (translocation) 1
dog(481238) megakaryoblastic leukemia (translocation) 1
domestic cat(101086071) megakaryoblastic leukemia (translocation) 1
cow(509011) megakaryoblastic leukemia (translocation) 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153049 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153049 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153049 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020831 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020831 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020831 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020831 Rosetta Predictions human pricing
XM_001077101 Rosetta Predictions rat pricing
XM_235497 Rosetta Predictions rat pricing
NM_001082536 Rosetta Predictions mouse pricing
NM_153049 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156467 predicted 877
2 SASI_Hs01_00156468 predicted 2764
3 SASI_Hs01_00156469 predicted 2863
4 SASI_Hs02_00354071 predicted 1977
5 SASI_Hs01_00156470 predicted 2839
6 SASI_Hs01_00156471 predicted 3689
7 SASI_Hs01_00156472 predicted 3329
8 SASI_Hs01_00156473 predicted 3174
9 SASI_Hs01_00156474 predicted 3539
10 SASI_Hs01_00156475 predicted 648
11 SASI_Hs01_00156476 predicted 3376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355786 predicted 490
2 SASI_Rn02_00355787 predicted 265
3 SASI_Rn02_00355788 predicted 873
4 SASI_Rn02_00355789 predicted 2918
5 SASI_Rn02_00355790 predicted 2827
6 SASI_Rn02_00355791 predicted 891
7 SASI_Rn02_00355792 predicted 1049
8 SASI_Rn02_00355793 predicted 423
9 SASI_Rn02_00355794 predicted 2858
10 SASI_Rn02_00355795 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389379 predicted 480
2 SASI_Rn02_00389380 predicted 251
3 SASI_Rn02_00389381 predicted 863
4 SASI_Rn02_00389382 predicted 2904
5 SASI_Rn02_00389383 predicted 2814
6 SASI_Rn02_00389384 predicted 881
7 SASI_Rn02_00389385 predicted 1037
8 SASI_Rn02_00389386 predicted 414
9 SASI_Rn02_00389387 predicted 2845
10 SASI_Rn02_00389388 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299312 predicted 851
2 SASI_Mm02_00299313 predicted 1684
3 SASI_Mm02_00299314 predicted 1885
4 SASI_Mm02_00299315 predicted 2908
5 SASI_Mm02_00299316 predicted 860
6 SASI_Mm02_00299317 predicted 3479
7 SASI_Mm02_00299318 predicted 874
8 SASI_Mm02_00299319 predicted 1071
9 SASI_Mm02_00299320 predicted 899
10 SASI_Mm02_00299321 predicted 2556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161560 predicted 2540
2 SASI_Mm01_00161564 predicted 589
3 SASI_Mm02_00342851 predicted 3217
4 SASI_Mm01_00161565 predicted 613
5 SASI_Mm02_00342852 predicted 599
6 SASI_Mm02_00342853 predicted 3248
7 SASI_Mm02_00342854 predicted 2534
8 SASI_Mm02_00342855 predicted 2575
9 SASI_Mm02_00342856 predicted 2570
10 SASI_Mm02_00342857 predicted 765
11 SASI_Mm01_00161561 predicted 1216
12 SASI_Mm01_00161562 predicted 1426
13 SASI_Mm01_00161563 predicted 2307
14 SASI_Mm01_00161566 predicted 612
15 SASI_Mm01_00161567 predicted 494
16 SASI_Mm01_00161568 predicted 2450
17 SASI_Mm01_00161569 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153049
VALIDATED
MKL1 MISSION shRNA Bacterial Glycerol Stock
megakaryoblastic leukemia (translocation) 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153049.2-3497s21c1
Sequence:CCGGCAGTCTTGGTGTATAGTATAACTCGAGTTATACTATACACCAAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153049.2-2537s21c1
Sequence:CCGGAGCACATGGATGATCTGTTTGCTCGAGCAAACAGATCATCCATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153049.2-601s21c1
Sequence:CCGGATCATTGTGGGCCAGGTAAATCTCGAGATTTACCTGGCCCACAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153049.2-2302s21c1
Sequence:CCGGATCCTCACTGTGACCAATAAGCTCGAGCTTATTGGTCACAGTGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153049.2-771s21c1
Sequence:CCGGATCACCCACTCAGGTTCTTTCCTCGAGGAAAGAACCTGAGTGGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153049.1-574s1c1
Sequence:CCGGCCCACTCAGGTTCTTTCTCAACTCGAGTTGAGAAAGAACCTGAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153049.1-2387s1c1
Sequence:CCGGCAGATTTCAAAGAGCCACCATCTCGAGATGGTGGCTCTTTGAAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153049.1-2110s1c1
Sequence:CCGGGTGACCAATAAGAGTGCTGATCTCGAGATCAGCACTCTTATTGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153049.1-171s1c1
Sequence:CCGGCGAGGACTATTTGAAACGGAACTCGAGTTCCGTTTCAAATAGTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153049.1-412s1c1
Sequence:CCGGCAGGTAAATTACCCAAAGGTACTCGAGTACCTTTGGGTAATTTACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153049
VALIDATED
MKL1 MISSION shRNA shRNA Plasmid DNA
megakaryoblastic leukemia (translocation) 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153049.2-3497s21c1
Sequence:CCGGCAGTCTTGGTGTATAGTATAACTCGAGTTATACTATACACCAAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153049.2-2537s21c1
Sequence:CCGGAGCACATGGATGATCTGTTTGCTCGAGCAAACAGATCATCCATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153049.2-601s21c1
Sequence:CCGGATCATTGTGGGCCAGGTAAATCTCGAGATTTACCTGGCCCACAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153049.2-2302s21c1
Sequence:CCGGATCCTCACTGTGACCAATAAGCTCGAGCTTATTGGTCACAGTGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153049.2-771s21c1
Sequence:CCGGATCACCCACTCAGGTTCTTTCCTCGAGGAAAGAACCTGAGTGGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153049.1-574s1c1
Sequence:CCGGCCCACTCAGGTTCTTTCTCAACTCGAGTTGAGAAAGAACCTGAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153049.1-2387s1c1
Sequence:CCGGCAGATTTCAAAGAGCCACCATCTCGAGATGGTGGCTCTTTGAAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153049.1-2110s1c1
Sequence:CCGGGTGACCAATAAGAGTGCTGATCTCGAGATCAGCACTCTTATTGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153049.1-171s1c1
Sequence:CCGGCGAGGACTATTTGAAACGGAACTCGAGTTCCGTTTCAAATAGTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153049.1-412s1c1
Sequence:CCGGCAGGTAAATTACCCAAAGGTACTCGAGTACCTTTGGGTAATTTACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153049
VALIDATED
MKL1 MISSION shRNA Lentiviral Transduction Particles
megakaryoblastic leukemia (translocation) 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153049.2-3497s21c1
Sequence:CCGGCAGTCTTGGTGTATAGTATAACTCGAGTTATACTATACACCAAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153049.2-2537s21c1
Sequence:CCGGAGCACATGGATGATCTGTTTGCTCGAGCAAACAGATCATCCATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153049.2-601s21c1
Sequence:CCGGATCATTGTGGGCCAGGTAAATCTCGAGATTTACCTGGCCCACAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153049.2-2302s21c1
Sequence:CCGGATCCTCACTGTGACCAATAAGCTCGAGCTTATTGGTCACAGTGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153049.2-771s21c1
Sequence:CCGGATCACCCACTCAGGTTCTTTCCTCGAGGAAAGAACCTGAGTGGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153049.1-574s1c1
Sequence:CCGGCCCACTCAGGTTCTTTCTCAACTCGAGTTGAGAAAGAACCTGAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153049.1-2387s1c1
Sequence:CCGGCAGATTTCAAAGAGCCACCATCTCGAGATGGTGGCTCTTTGAAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153049.1-2110s1c1
Sequence:CCGGGTGACCAATAAGAGTGCTGATCTCGAGATCAGCACTCTTATTGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153049.1-171s1c1
Sequence:CCGGCGAGGACTATTTGAAACGGAACTCGAGTTCCGTTTCAAATAGTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153049.1-412s1c1
Sequence:CCGGCAGGTAAATTACCCAAAGGTACTCGAGTACCTTTGGGTAATTTACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020831
VALIDATED
MKL1 MISSION shRNA Bacterial Glycerol Stock
megakaryoblastic leukemia (translocation) 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_020831.3-891s21c1
Sequence:CCGGTTGTGGGCCAGGTGAACTATCCTCGAGGATAGTTCACCTGGCCCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020831.3-3341s21c1
Sequence:CCGGTTCCTCGATGGCCATGATTTGCTCGAGCAAATCATGGCCATCGAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020831.3-3684s21c1
Sequence:CCGGCTGTCTGTCTGGCTACAATTTCTCGAGAAATTGTAGCCAGACAGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_020831.3-1297s21c1
Sequence:CCGGGCTCAAGTACCACCAGTACATCTCGAGATGTACTGGTGGTACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020831.2-1255s1c1
Sequence:CCGGGCTCAAGTACCACCAGTACATCTCGAGATGTACTGGTGGTACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_020831.3-662s21c1
Sequence:CCGGGACTATCTCAAACGGAAGATTCTCGAGAATCTTCCGTTTGAGATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_020831.2-2823s1c1
Sequence:CCGGGCGGAGAAATTTCAGCAGATTCTCGAGAATCTGCTGAAATTTCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_020831.2-1735s1c1
Sequence:CCGGCGCCACCTCTATCCTGCACAACTCGAGTTGTGCAGGATAGAGGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020831.2-620s1c1
Sequence:CCGGGACTATCTCAAACGGAAGATTCTCGAGAATCTTCCGTTTGAGATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_020831.2-1123s1c1
Sequence:CCGGCCTCACCAATGGAACCACTATCTCGAGATAGTGGTTCCATTGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020831
VALIDATED
MKL1 MISSION shRNA shRNA Plasmid DNA
megakaryoblastic leukemia (translocation) 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_020831.3-891s21c1
Sequence:CCGGTTGTGGGCCAGGTGAACTATCCTCGAGGATAGTTCACCTGGCCCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020831.3-3341s21c1
Sequence:CCGGTTCCTCGATGGCCATGATTTGCTCGAGCAAATCATGGCCATCGAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020831.3-3684s21c1
Sequence:CCGGCTGTCTGTCTGGCTACAATTTCTCGAGAAATTGTAGCCAGACAGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_020831.3-1297s21c1
Sequence:CCGGGCTCAAGTACCACCAGTACATCTCGAGATGTACTGGTGGTACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020831.2-1255s1c1
Sequence:CCGGGCTCAAGTACCACCAGTACATCTCGAGATGTACTGGTGGTACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_020831.3-662s21c1
Sequence:CCGGGACTATCTCAAACGGAAGATTCTCGAGAATCTTCCGTTTGAGATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_020831.2-2823s1c1
Sequence:CCGGGCGGAGAAATTTCAGCAGATTCTCGAGAATCTGCTGAAATTTCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_020831.2-1735s1c1
Sequence:CCGGCGCCACCTCTATCCTGCACAACTCGAGTTGTGCAGGATAGAGGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020831.2-620s1c1
Sequence:CCGGGACTATCTCAAACGGAAGATTCTCGAGAATCTTCCGTTTGAGATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_020831.2-1123s1c1
Sequence:CCGGCCTCACCAATGGAACCACTATCTCGAGATAGTGGTTCCATTGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020831
VALIDATED
MKL1 MISSION shRNA Lentiviral Transduction Particles
megakaryoblastic leukemia (translocation) 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_020831.3-891s21c1
Sequence:CCGGTTGTGGGCCAGGTGAACTATCCTCGAGGATAGTTCACCTGGCCCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020831.3-3341s21c1
Sequence:CCGGTTCCTCGATGGCCATGATTTGCTCGAGCAAATCATGGCCATCGAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020831.3-3684s21c1
Sequence:CCGGCTGTCTGTCTGGCTACAATTTCTCGAGAAATTGTAGCCAGACAGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_020831.3-1297s21c1
Sequence:CCGGGCTCAAGTACCACCAGTACATCTCGAGATGTACTGGTGGTACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020831.2-1255s1c1
Sequence:CCGGGCTCAAGTACCACCAGTACATCTCGAGATGTACTGGTGGTACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_020831.3-662s21c1
Sequence:CCGGGACTATCTCAAACGGAAGATTCTCGAGAATCTTCCGTTTGAGATAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_020831.2-2823s1c1
Sequence:CCGGGCGGAGAAATTTCAGCAGATTCTCGAGAATCTGCTGAAATTTCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_020831.2-1735s1c1
Sequence:CCGGCGCCACCTCTATCCTGCACAACTCGAGTTGTGCAGGATAGAGGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020831.2-620s1c1
Sequence:CCGGGACTATCTCAAACGGAAGATTCTCGAGAATCTTCCGTTTGAGATAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_020831.2-1123s1c1
Sequence:CCGGCCTCACCAATGGAACCACTATCTCGAGATAGTGGTTCCATTGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)