EMAIL THIS PAGE TO A FRIEND

MKL2

MKL/myocardin-like 2

238 Gene Product Result for
Synonyms: MRTF-B NPD001
UniProtKB ID: Q9ULH7, A6ND53, Q68CT1, Q6UB16, Q86WW2, Q8N226
Gene ID:
Mouse(239719) MKL/myocardin-like 2
chicken(416421) MKL/myocardin-like 2
cow(511461) MKL/myocardin-like 2
Horse(100050736) MKL/myocardin-like 2
domestic cat(101100272) MKL/myocardin-like 2
dog(489999) MKL/myocardin-like 2
domestic guinea pig(100731881) MKL/myocardin-like 2
naked mole-rat(101716419) MKL/myocardin-like 2
Domestic Rabbit(100350900) MKL/myocardin-like 2
sheep(101111928) MKL/myocardin-like 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181860 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181860 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181860 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014048 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014048 Rosetta Predictions human pricing
NM_001122667 Rosetta Predictions mouse pricing
NM_153588 Rosetta Predictions mouse pricing
NM_181860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016806 predicted 2386
2 SASI_Hs02_00345053 predicted 2979
3 SASI_Hs01_00016807 predicted 603
4 SASI_Hs01_00016808 predicted 1226
5 SASI_Hs02_00345054 predicted 2605
6 SASI_Hs02_00345055 predicted 470
7 SASI_Hs01_00016809 predicted 1067
8 SASI_Hs01_00016811 predicted 639
9 SASI_Hs01_00016813 predicted 2929
10 SASI_Hs01_00016815 predicted 251
11 SASI_Hs01_00016810 predicted 868
12 SASI_Hs01_00016812 predicted 1086
13 SASI_Hs01_00016814 predicted 2706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309190 predicted 2566
2 SASI_Mm02_00309191 predicted 3038
3 SASI_Mm02_00309192 predicted 1731
4 SASI_Mm02_00309193 predicted 2568
5 SASI_Mm02_00309194 predicted 3202
6 SASI_Mm02_00309195 predicted 1498
7 SASI_Mm02_00309196 predicted 668
8 SASI_Mm02_00309197 predicted 676
9 SASI_Mm02_00309198 predicted 1546
10 SASI_Mm02_00309199 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124139 predicted 2577
2 SASI_Mm01_00124140 predicted 3059
3 SASI_Mm01_00124142 predicted 1742
4 SASI_Mm01_00124143 predicted 2582
5 SASI_Mm01_00124144 predicted 3217
6 SASI_Mm01_00124145 predicted 1514
7 SASI_Mm01_00124146 predicted 682
8 SASI_Mm02_00343418 predicted 687
9 SASI_Mm01_00124148 predicted 1567
10 SASI_Mm02_00343419 predicted 718
11 SASI_Mm01_00124141 predicted 2588
12 SASI_Mm01_00124147 predicted 2535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199147 predicted 342
2 SASI_Mm01_00199148 predicted 307
3 SASI_Mm01_00199149 predicted 332
4 SASI_Mm01_00199150 predicted 228
5 SASI_Mm01_00199151 predicted 230
6 SASI_Mm01_00199152 predicted 230
7 SASI_Mm01_00199153 predicted 340
8 SASI_Mm01_00199154 predicted 391
9 SASI_Mm02_00349946 predicted 307
10 SASI_Mm01_00199156 predicted 390
11 SASI_Mm01_00199155 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181860
MKL2 MISSION shRNA Bacterial Glycerol Stock
MKL/myocardin-like 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000196178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181860.1-344s1c1
Sequence:CCGGGAAGCCTCATTTGCCACTAGTCTCGAGACTAGTGGCAAATGAGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181860.1-563s1c1
Sequence:CCGGCACATCTCTCATGGTGTTGAACTCGAGTTCAACACCATGAGAGATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181860.1-347s1c1
Sequence:CCGGGCCTCATTTGCCACTAGTCTTCTCGAGAAGACTAGTGGCAAATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181860.1-231s1c1
Sequence:CCGGCACTTACCCACTCTGAACGAACTCGAGTTCGTTCAGAGTGGGTAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181860
MKL2 MISSION shRNA shRNA Plasmid DNA
MKL/myocardin-like 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000196178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181860.1-344s1c1
Sequence:CCGGGAAGCCTCATTTGCCACTAGTCTCGAGACTAGTGGCAAATGAGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181860.1-563s1c1
Sequence:CCGGCACATCTCTCATGGTGTTGAACTCGAGTTCAACACCATGAGAGATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181860.1-347s1c1
Sequence:CCGGGCCTCATTTGCCACTAGTCTTCTCGAGAAGACTAGTGGCAAATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181860.1-231s1c1
Sequence:CCGGCACTTACCCACTCTGAACGAACTCGAGTTCGTTCAGAGTGGGTAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181860
MKL2 MISSION shRNA Lentiviral Transduction Particles
MKL/myocardin-like 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000196178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181860.1-344s1c1
Sequence:CCGGGAAGCCTCATTTGCCACTAGTCTCGAGACTAGTGGCAAATGAGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181860.1-563s1c1
Sequence:CCGGCACATCTCTCATGGTGTTGAACTCGAGTTCAACACCATGAGAGATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181860.1-347s1c1
Sequence:CCGGGCCTCATTTGCCACTAGTCTTCTCGAGAAGACTAGTGGCAAATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181860.1-231s1c1
Sequence:CCGGCACTTACCCACTCTGAACGAACTCGAGTTCGTTCAGAGTGGGTAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014048
VALIDATED
MKL2 MISSION shRNA Bacterial Glycerol Stock
MKL/myocardin-like 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-1427s21c1
Sequence:CCGGGGACCTCATTGAGCGCCTAAACTCGAGTTTAGGCGCTCAATGAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-2972s21c1
Sequence:CCGGTTTACCCTCAGCCAATGAAATCTCGAGATTTCATTGGCTGAGGGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_014048.3-646s1c1
Sequence:CCGGCCAGTGTTAAAGAAGCAATTACTCGAGTAATTGCTTCTTTAACACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014048.3-1722s1c1
Sequence:CCGGGCAGACACTTTCACCGAGATTCTCGAGAATCTCGGTGAAAGTGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014048.3-2753s1c1
Sequence:CCGGCCTCATTAAGAGTGGAGAGATCTCGAGATCTCTCCACTCTTAATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014048.3-1550s1c1
Sequence:CCGGGCCGGTTACAACACTACACAACTCGAGTTGTGTAGTGTTGTAACCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014048.3-2931s1c1
Sequence:CCGGGCCAGCTTAGAGAACCAACTACTCGAGTAGTTGGTTCTCTAAGCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-1347s21c1
Sequence:CCGGTCTAGCCTGGATGACTTAAAGCTCGAGCTTTAAGTCATCCAGGCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014048.3-3538s21c1
Sequence:CCGGCAAAGACGACTCATCTATTTCCTCGAGGAAATAGATGAGTCGTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014048.3-3668s21c1
Sequence:CCGGGGTCACTTTAAGACCCTAAATCTCGAGATTTAGGGTCTTAAAGTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-1725s21c1
Sequence:CCGGGACACTTTCACCGAGATTATGCTCGAGCATAATCTCGGTGAAAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-1038s21c1
Sequence:CCGGGATCCCAAACCACGGGTAAAGCTCGAGCTTTACCCGTGGTTTGGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-649s21c1
Sequence:CCGGGTGTTAAAGAAGCAATTATAGCTCGAGCTATAATTGCTTCTTTAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014048.3-3630s21c1
Sequence:CCGGACGTTAGGATTCTGGTAATTACTCGAGTAATTACCAGAATCCTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-2600s21c1
Sequence:CCGGTGTCGTCCAGCACTCTCTATTCTCGAGAATAGAGAGTGCTGGACGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-1722s21c1
Sequence:CCGGGCAGACACTTTCACCGAGATTCTCGAGAATCTCGGTGAAAGTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014048
VALIDATED
MKL2 MISSION shRNA shRNA Plasmid DNA
MKL/myocardin-like 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-1427s21c1
Sequence:CCGGGGACCTCATTGAGCGCCTAAACTCGAGTTTAGGCGCTCAATGAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-2972s21c1
Sequence:CCGGTTTACCCTCAGCCAATGAAATCTCGAGATTTCATTGGCTGAGGGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_014048.3-646s1c1
Sequence:CCGGCCAGTGTTAAAGAAGCAATTACTCGAGTAATTGCTTCTTTAACACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014048.3-1722s1c1
Sequence:CCGGGCAGACACTTTCACCGAGATTCTCGAGAATCTCGGTGAAAGTGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014048.3-2753s1c1
Sequence:CCGGCCTCATTAAGAGTGGAGAGATCTCGAGATCTCTCCACTCTTAATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014048.3-1550s1c1
Sequence:CCGGGCCGGTTACAACACTACACAACTCGAGTTGTGTAGTGTTGTAACCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014048.3-2931s1c1
Sequence:CCGGGCCAGCTTAGAGAACCAACTACTCGAGTAGTTGGTTCTCTAAGCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-1347s21c1
Sequence:CCGGTCTAGCCTGGATGACTTAAAGCTCGAGCTTTAAGTCATCCAGGCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014048.3-3538s21c1
Sequence:CCGGCAAAGACGACTCATCTATTTCCTCGAGGAAATAGATGAGTCGTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014048.3-3668s21c1
Sequence:CCGGGGTCACTTTAAGACCCTAAATCTCGAGATTTAGGGTCTTAAAGTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-1725s21c1
Sequence:CCGGGACACTTTCACCGAGATTATGCTCGAGCATAATCTCGGTGAAAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-1038s21c1
Sequence:CCGGGATCCCAAACCACGGGTAAAGCTCGAGCTTTACCCGTGGTTTGGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-649s21c1
Sequence:CCGGGTGTTAAAGAAGCAATTATAGCTCGAGCTATAATTGCTTCTTTAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014048.3-3630s21c1
Sequence:CCGGACGTTAGGATTCTGGTAATTACTCGAGTAATTACCAGAATCCTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-2600s21c1
Sequence:CCGGTGTCGTCCAGCACTCTCTATTCTCGAGAATAGAGAGTGCTGGACGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-1722s21c1
Sequence:CCGGGCAGACACTTTCACCGAGATTCTCGAGAATCTCGGTGAAAGTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014048
VALIDATED
MKL2 MISSION shRNA Lentiviral Transduction Particles
MKL/myocardin-like 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-1427s21c1
Sequence:CCGGGGACCTCATTGAGCGCCTAAACTCGAGTTTAGGCGCTCAATGAGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-2972s21c1
Sequence:CCGGTTTACCCTCAGCCAATGAAATCTCGAGATTTCATTGGCTGAGGGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_014048.3-646s1c1
Sequence:CCGGCCAGTGTTAAAGAAGCAATTACTCGAGTAATTGCTTCTTTAACACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014048.3-1722s1c1
Sequence:CCGGGCAGACACTTTCACCGAGATTCTCGAGAATCTCGGTGAAAGTGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014048.3-2753s1c1
Sequence:CCGGCCTCATTAAGAGTGGAGAGATCTCGAGATCTCTCCACTCTTAATGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014048.3-1550s1c1
Sequence:CCGGGCCGGTTACAACACTACACAACTCGAGTTGTGTAGTGTTGTAACCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014048.3-2931s1c1
Sequence:CCGGGCCAGCTTAGAGAACCAACTACTCGAGTAGTTGGTTCTCTAAGCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-1347s21c1
Sequence:CCGGTCTAGCCTGGATGACTTAAAGCTCGAGCTTTAAGTCATCCAGGCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014048.3-3538s21c1
Sequence:CCGGCAAAGACGACTCATCTATTTCCTCGAGGAAATAGATGAGTCGTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014048.3-3668s21c1
Sequence:CCGGGGTCACTTTAAGACCCTAAATCTCGAGATTTAGGGTCTTAAAGTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-1725s21c1
Sequence:CCGGGACACTTTCACCGAGATTATGCTCGAGCATAATCTCGGTGAAAGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-1038s21c1
Sequence:CCGGGATCCCAAACCACGGGTAAAGCTCGAGCTTTACCCGTGGTTTGGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-649s21c1
Sequence:CCGGGTGTTAAAGAAGCAATTATAGCTCGAGCTATAATTGCTTCTTTAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014048.3-3630s21c1
Sequence:CCGGACGTTAGGATTCTGGTAATTACTCGAGTAATTACCAGAATCCTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-2600s21c1
Sequence:CCGGTGTCGTCCAGCACTCTCTATTCTCGAGAATAGAGAGTGCTGGACGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014048.3-1722s21c1
Sequence:CCGGGCAGACACTTTCACCGAGATTCTCGAGAATCTCGGTGAAAGTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153588
MKL2 MISSION shRNA Bacterial Glycerol Stock
MKL/myocardin-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153588.1-1344s1c1
Sequence:CCGGGCCAGTCACAACACTGCATAACTCGAGTTATGCAGTGTTGTGACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153588.1-2691s1c1
Sequence:CCGGCCTCATAAAGAGTGGAGAGATCTCGAGATCTCTCCACTCTTTATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153588.1-808s1c1
Sequence:CCGGCCCAAGAATCCAAACGACAAACTCGAGTTTGTCGTTTGGATTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153588.1-2948s1c1
Sequence:CCGGGCAGTGAAGATAGAGAGTCTTCTCGAGAAGACTCTCTATCTTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153588.1-1817s1c1
Sequence:CCGGCCTTTAATACATCAGATCCTACTCGAGTAGGATCTGATGTATTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153588
MKL2 MISSION shRNA shRNA Plasmid DNA
MKL/myocardin-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153588.1-1344s1c1
Sequence:CCGGGCCAGTCACAACACTGCATAACTCGAGTTATGCAGTGTTGTGACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153588.1-2691s1c1
Sequence:CCGGCCTCATAAAGAGTGGAGAGATCTCGAGATCTCTCCACTCTTTATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153588.1-808s1c1
Sequence:CCGGCCCAAGAATCCAAACGACAAACTCGAGTTTGTCGTTTGGATTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153588.1-2948s1c1
Sequence:CCGGGCAGTGAAGATAGAGAGTCTTCTCGAGAAGACTCTCTATCTTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153588.1-1817s1c1
Sequence:CCGGCCTTTAATACATCAGATCCTACTCGAGTAGGATCTGATGTATTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153588
MKL2 MISSION shRNA Lentiviral Transduction Particles
MKL/myocardin-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153588.1-1344s1c1
Sequence:CCGGGCCAGTCACAACACTGCATAACTCGAGTTATGCAGTGTTGTGACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153588.1-2691s1c1
Sequence:CCGGCCTCATAAAGAGTGGAGAGATCTCGAGATCTCTCCACTCTTTATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153588.1-808s1c1
Sequence:CCGGCCCAAGAATCCAAACGACAAACTCGAGTTTGTCGTTTGGATTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153588.1-2948s1c1
Sequence:CCGGGCAGTGAAGATAGAGAGTCTTCTCGAGAAGACTCTCTATCTTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153588.1-1817s1c1
Sequence:CCGGCCTTTAATACATCAGATCCTACTCGAGTAGGATCTGATGTATTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)