EMAIL THIS PAGE TO A FRIEND

MKLN1

muskelin 1, intracellular mediator containing kelch motifs

94 Gene Product Result for
Synonyms: TWA2
UniProtKB ID: Q9UL63, A4D1M8, A6NG43, Q9NSK4, Q9NUS8
Gene ID:
Human(4289) Summary: Muskelin is an intracellular protein that acts as a mediator of cell spreading and cytoskeletal responses to the extracellular matrix component thrombospondin I (MIM 188060) (Adams et al., 1998 [PubMed 9724633]
Mouse(27418) muskelin 1, intracellular mediator containing kelch motifs
Rat(83536) muskelin 1, intracellular mediator containing kelch motifs
sheep(101119131) muskelin 1, intracellular mediator containing kelch motifs
Domestic Rabbit(100346273) muskelin 1, intracellular mediator containing kelch motifs
naked mole-rat(101725197) muskelin 1, intracellular mediator containing kelch motifs
domestic guinea pig(100727854) muskelin 1, intracellular mediator containing kelch motifs
Zebrafish(325217) muskelin 1, intracellular mediator containing kelch motifs
cow(508844) muskelin 1, intracellular mediator containing kelch motifs
domestic cat(101091608) muskelin 1, intracellular mediator containing kelch motifs
dog(608286) muskelin 1, intracellular mediator containing kelch motifs
chicken(418250) muskelin 1, intracellular mediator containing kelch motifs
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013255 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013255 Rosetta Predictions human pricing
NM_031359 Rosetta Predictions rat pricing
NM_013791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185622 predicted 335
2 SASI_Hs01_00185623 predicted 713
3 SASI_Hs02_00344472 predicted 258
4 SASI_Hs01_00185624 predicted 1529
5 SASI_Hs01_00185625 predicted 1848
6 SASI_Hs01_00185626 predicted 1245
7 SASI_Hs01_00185627 predicted 2148
8 SASI_Hs01_00185628 predicted 1675
9 SASI_Hs01_00185629 predicted 1684
10 SASI_Hs01_00185630 predicted 1715
11 SASI_Hs01_00185631 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056844 predicted 1627
2 SASI_Rn02_00264619 predicted 641
3 SASI_Rn01_00056845 predicted 1965
4 SASI_Rn01_00056846 predicted 594
5 SASI_Rn01_00056847 predicted 1895
6 SASI_Rn01_00056849 predicted 2063
7 SASI_Rn01_00056851 predicted 242
8 SASI_Rn01_00056852 predicted 502
9 SASI_Rn01_00056853 predicted 1952
10 SASI_Rn02_00264620 predicted 871
11 SASI_Rn01_00056848 predicted 994
12 SASI_Rn01_00056850 predicted 2199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322744 predicted 676
2 SASI_Mm01_00175139 predicted 1473
3 SASI_Mm01_00175140 predicted 1114
4 SASI_Mm01_00175142 predicted 1020
5 SASI_Mm01_00175143 predicted 723
6 SASI_Mm01_00175144 predicted 1126
7 SASI_Mm01_00175145 predicted 1921
8 SASI_Mm02_00322745 predicted 2149
9 SASI_Mm01_00175147 predicted 1857
10 SASI_Mm01_00175148 predicted 1330
11 SASI_Mm01_00175141 predicted 1599
12 SASI_Mm01_00175146 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013255
VALIDATED
MKLN1 MISSION shRNA Bacterial Glycerol Stock
muskelin 1, intracellular mediator containing kelch motifs
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_013255.3-8934s1c1
Sequence:CCGGGCCTCAAATAATACCAAGTTACTCGAGTAACTTGGTATTATTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013255.3-669s1c1
Sequence:CCGGGCTGGTGTTGAAGGGTGATTTCTCGAGAAATCACCCTTCAACACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013255.3-631s1c1
Sequence:CCGGGCACTGGAACATCCCATGTTACTCGAGTAACATGGGATGTTCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013255.3-1448s1c1
Sequence:CCGGGCCAGCGATCAAAGACCTATTCTCGAGAATAGGTCTTTGATCGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013255.3-1449s1c1
Sequence:CCGGCCAGCGATCAAAGACCTATTTCTCGAGAAATAGGTCTTTGATCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013255.4-671s21c1
Sequence:CCGGGCACTGGAACATCCCATGTTACTCGAGTAACATGGGATGTTCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013255.4-8974s21c1
Sequence:CCGGGCCTCAAATAATACCAAGTTACTCGAGTAACTTGGTATTATTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013255.4-1488s21c1
Sequence:CCGGGCCAGCGATCAAAGACCTATTCTCGAGAATAGGTCTTTGATCGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013255.4-709s21c1
Sequence:CCGGGCTGGTGTTGAAGGGTGATTTCTCGAGAAATCACCCTTCAACACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013255
VALIDATED
MKLN1 MISSION shRNA shRNA Plasmid DNA
muskelin 1, intracellular mediator containing kelch motifs
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_013255.3-8934s1c1
Sequence:CCGGGCCTCAAATAATACCAAGTTACTCGAGTAACTTGGTATTATTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013255.3-669s1c1
Sequence:CCGGGCTGGTGTTGAAGGGTGATTTCTCGAGAAATCACCCTTCAACACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013255.3-631s1c1
Sequence:CCGGGCACTGGAACATCCCATGTTACTCGAGTAACATGGGATGTTCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013255.3-1448s1c1
Sequence:CCGGGCCAGCGATCAAAGACCTATTCTCGAGAATAGGTCTTTGATCGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013255.3-1449s1c1
Sequence:CCGGCCAGCGATCAAAGACCTATTTCTCGAGAAATAGGTCTTTGATCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013255.4-671s21c1
Sequence:CCGGGCACTGGAACATCCCATGTTACTCGAGTAACATGGGATGTTCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013255.4-8974s21c1
Sequence:CCGGGCCTCAAATAATACCAAGTTACTCGAGTAACTTGGTATTATTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013255.4-1488s21c1
Sequence:CCGGGCCAGCGATCAAAGACCTATTCTCGAGAATAGGTCTTTGATCGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013255.4-709s21c1
Sequence:CCGGGCTGGTGTTGAAGGGTGATTTCTCGAGAAATCACCCTTCAACACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013255
VALIDATED
MKLN1 MISSION shRNA Lentiviral Transduction Particles
muskelin 1, intracellular mediator containing kelch motifs
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_013255.3-8934s1c1
Sequence:CCGGGCCTCAAATAATACCAAGTTACTCGAGTAACTTGGTATTATTTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013255.3-669s1c1
Sequence:CCGGGCTGGTGTTGAAGGGTGATTTCTCGAGAAATCACCCTTCAACACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013255.3-631s1c1
Sequence:CCGGGCACTGGAACATCCCATGTTACTCGAGTAACATGGGATGTTCCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013255.3-1448s1c1
Sequence:CCGGGCCAGCGATCAAAGACCTATTCTCGAGAATAGGTCTTTGATCGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013255.3-1449s1c1
Sequence:CCGGCCAGCGATCAAAGACCTATTTCTCGAGAAATAGGTCTTTGATCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013255.4-671s21c1
Sequence:CCGGGCACTGGAACATCCCATGTTACTCGAGTAACATGGGATGTTCCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013255.4-8974s21c1
Sequence:CCGGGCCTCAAATAATACCAAGTTACTCGAGTAACTTGGTATTATTTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013255.4-1488s21c1
Sequence:CCGGGCCAGCGATCAAAGACCTATTCTCGAGAATAGGTCTTTGATCGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013255.4-709s21c1
Sequence:CCGGGCTGGTGTTGAAGGGTGATTTCTCGAGAAATCACCCTTCAACACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013791
VALIDATED
MKLN1 MISSION shRNA Bacterial Glycerol Stock
muskelin 1, intracellular mediator containing kelch motifs
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013791.1-648s1c1
Sequence:CCGGGCATGACAAATTGGTGTTAAACTCGAGTTTAACACCAATTTGTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013791.1-1768s1c1
Sequence:CCGGGCCCATCAACTCGTTTATGATCTCGAGATCATAAACGAGTTGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013791.1-3222s1c1
Sequence:CCGGGCATACAATTTACAGGCATTTCTCGAGAAATGCCTGTAAATTGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013791.1-432s1c1
Sequence:CCGGGCCCAGCTTTAACTTTAGCATCTCGAGATGCTAAAGTTAAAGCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013791.1-1020s1c1
Sequence:CCGGGCGGAGACAAATCTACACATTCTCGAGAATGTGTAGATTTGTCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013791.2-2479s21c1
Sequence:CCGGTAGCCTTTAAGAATTAGTAAGCTCGAGCTTACTAATTCTTAAAGGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013791.2-2579s21c1
Sequence:CCGGGACTTGGTGCTGTAGGAATTTCTCGAGAAATTCCTACAGCACCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013791
VALIDATED
MKLN1 MISSION shRNA shRNA Plasmid DNA
muskelin 1, intracellular mediator containing kelch motifs
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013791.1-648s1c1
Sequence:CCGGGCATGACAAATTGGTGTTAAACTCGAGTTTAACACCAATTTGTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013791.1-1768s1c1
Sequence:CCGGGCCCATCAACTCGTTTATGATCTCGAGATCATAAACGAGTTGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013791.1-3222s1c1
Sequence:CCGGGCATACAATTTACAGGCATTTCTCGAGAAATGCCTGTAAATTGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013791.1-432s1c1
Sequence:CCGGGCCCAGCTTTAACTTTAGCATCTCGAGATGCTAAAGTTAAAGCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013791.1-1020s1c1
Sequence:CCGGGCGGAGACAAATCTACACATTCTCGAGAATGTGTAGATTTGTCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013791.2-2479s21c1
Sequence:CCGGTAGCCTTTAAGAATTAGTAAGCTCGAGCTTACTAATTCTTAAAGGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013791.2-2579s21c1
Sequence:CCGGGACTTGGTGCTGTAGGAATTTCTCGAGAAATTCCTACAGCACCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013791
VALIDATED
MKLN1 MISSION shRNA Lentiviral Transduction Particles
muskelin 1, intracellular mediator containing kelch motifs
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013791.1-648s1c1
Sequence:CCGGGCATGACAAATTGGTGTTAAACTCGAGTTTAACACCAATTTGTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013791.1-1768s1c1
Sequence:CCGGGCCCATCAACTCGTTTATGATCTCGAGATCATAAACGAGTTGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013791.1-3222s1c1
Sequence:CCGGGCATACAATTTACAGGCATTTCTCGAGAAATGCCTGTAAATTGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013791.1-432s1c1
Sequence:CCGGGCCCAGCTTTAACTTTAGCATCTCGAGATGCTAAAGTTAAAGCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013791.1-1020s1c1
Sequence:CCGGGCGGAGACAAATCTACACATTCTCGAGAATGTGTAGATTTGTCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013791.2-2479s21c1
Sequence:CCGGTAGCCTTTAAGAATTAGTAAGCTCGAGCTTACTAATTCTTAAAGGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013791.2-2579s21c1
Sequence:CCGGGACTTGGTGCTGTAGGAATTTCTCGAGAAATTCCTACAGCACCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)