EMAIL THIS PAGE TO A FRIEND

MKNK2

MAP kinase interacting serine/threonine kinase 2

98 Gene Product Result for
Synonyms: GPRK7 MNK2
UniProtKB ID: Q9HBH9, Q6GPI3, Q9HBH8, Q9UHR0, Q9Y2N6
Gene ID:
Human(2872) Summary: This gene encodes a member of the calcium/calmodulin-dependent protein kinases (CAMK) Ser/Thr protein kinase family, which belongs to the protein kinase superfamily. This protein contains conserved DLG (asp-leu-gly) and ENIL (glu-asn-ile-leu) motifs, and an N-terminal polybasic region which binds importin A and the translation factor scaffold protein eukaryotic initiation factor 4G (eIF4G). This protein is one of the downstream kinases activated by mitogen-activated protein (MAP) kinases. It phosphorylates the eukaryotic initiation factor 4E (eIF4E), thus playing important roles in the initiation of mRNA translation, oncogenic transformation and malignant cell proliferation. In addition to eIF4E, this protein also interacts with von Hippel-Lindau tumor suppressor (VHL), ring-box 1 (Rbx1) and Cullin2 (Cul2), which are all components of the CBC(VHL) ubiquitin ligase E3 complex. Multiple alternatively spliced transcript variants have been found, but the full-length nature and biological activity of only two variants are determined. These two variants encode distinct isoforms which differ in activity and regulation, and in subcellular localization. [provided by RefSeq, Aug 2011]
Mouse(17347) MAP kinase-interacting serine/threonine kinase 2
Rat(299618) MAP kinase-interacting serine/threonine kinase 2
chicken(429269) MAP kinase interacting serine/threonine kinase 2
cow(538519) MAP kinase interacting serine/threonine kinase 2
domestic cat(101087206) MAP kinase interacting serine/threonine kinase 2
dog(612212) MAP kinase interacting serine/threonine kinase 2
naked mole-rat(101716935) MAP kinase interacting serine/threonine kinase 2
domestic guinea pig(100734192) MAP kinase interacting serine/threonine kinase 2
sheep(101122519) MAP kinase interacting serine/threonine kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M0823 Anti-MKNK2 (402-415) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA070499 Anti-MKNK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA021875 Anti-MKNK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2101483 Anti-MKNK2 antibody produced in rabbit affinity isolated antibody mouse, rat, horse, guinea pig, human, dog
immunohistochemistry, western blot pricing
HPA053989 Anti-MKNK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1306029 ANTI-MNK2 (MKNK2)(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1306024 ANTI-MNK2 (MKNK2)(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
M0696 Anti-MNK2 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution mouse (predicted), rat (predicted), human
immunocytochemistry, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1304716 ANTI-MOUSE MKNK2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
WH0002872M4 Monoclonal Anti-MKNK2 antibody produced in mouse clone 4F11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403881 Monoclonal Anti-MKNK2 antibody produced in mouse clone 2A10, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017572 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017572 Rosetta Predictions human pricing
NM_199054 Rosetta Predictions human pricing
NM_001011985 Rosetta Predictions rat pricing
XM_576180 Rosetta Predictions rat pricing
NM_021462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175136 predicted 816
2 SASI_Hs01_00175137 predicted 1089
3 SASI_Hs01_00175138 predicted 810
4 SASI_Hs01_00175139 predicted 696
5 SASI_Hs01_00175140 predicted 667
6 SASI_Hs01_00175141 predicted 565
7 SASI_Hs01_00175142 predicted 456
8 SASI_Hs01_00175143 predicted 660
9 SASI_Hs01_00175144 predicted 666
10 SASI_Hs01_00175145 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118926 predicted 817
2 SASI_Hs01_00118927 predicted 1089
3 SASI_Hs01_00118928 predicted 814
4 SASI_Hs01_00118929 predicted 697
5 SASI_Hs01_00118930 predicted 668
6 SASI_Hs01_00118931 predicted 567
7 SASI_Hs01_00118932 predicted 456
8 SASI_Hs01_00118933 predicted 666
9 SASI_Hs01_00118934 predicted 663
10 SASI_Hs01_00118935 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011985 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107925 predicted 557
2 SASI_Rn02_00200013 predicted 661
3 SASI_Rn01_00107926 predicted 832
4 SASI_Rn01_00107928 predicted 1151
5 SASI_Rn01_00107930 predicted 719
6 SASI_Rn01_00107931 predicted 562
7 SASI_Rn01_00107932 predicted 365
8 SASI_Rn02_00200014 predicted 662
9 SASI_Rn01_00107933 predicted 827
10 SASI_Rn01_00107934 predicted 605
11 SASI_Rn01_00107927 predicted 378
12 SASI_Rn01_00107929 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00134388 predicted 567
2 SASI_Rn01_00134389 predicted 829
3 SASI_Rn01_00134390 predicted 368
4 SASI_Rn01_00134391 predicted 1152
5 SASI_Rn01_00134392 predicted 325
6 SASI_Rn01_00134393 predicted 731
7 SASI_Rn01_00134394 predicted 563
8 SASI_Rn01_00134395 predicted 376
9 SASI_Rn01_00134396 predicted 837
10 SASI_Rn01_00134397 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160359 predicted 596
2 SASI_Mm01_00160360 predicted 1291
3 SASI_Mm01_00160361 predicted 560
4 SASI_Mm01_00160364 predicted 1160
5 SASI_Mm01_00160365 predicted 1365
6 SASI_Mm01_00160366 predicted 414
7 SASI_Mm01_00160367 predicted 480
8 SASI_Mm02_00326114 predicted 586
9 SASI_Mm02_00326115 predicted 419
10 SASI_Mm02_00326116 predicted 584
11 SASI_Mm01_00160358 predicted 1063
12 SASI_Mm01_00160362 predicted 920
13 SASI_Mm01_00160363 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017572
VALIDATED
MKNK2 MISSION shRNA Bacterial Glycerol Stock
MAP kinase interacting serine/threonine kinase 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017572.3-475s21c1
Sequence:CCGGGCAGGTTTGAAGACGTCTACCCTCGAGGGTAGACGTCTTCAAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017572.3-575s21c1
Sequence:CCGGCGCCGTCAAGATCATTGAGAACTCGAGTTCTCAATGATCTTGACGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017572.3-1550s21c1
Sequence:CCGGCATGTGTTAATGTTACGATGTCTCGAGACATCGTAACATTAACACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017572.2-1037s1c1
Sequence:CCGGGAGGCTAGCATCTACGACAAGCTCGAGCTTGTCGTAGATGCTAGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017572.2-534s1c1
Sequence:CCGGCCTGCATCAACCTGATCACCACTCGAGTGGTGATCAGGTTGATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017572.2-304s1c1
Sequence:CCGGGCTGGCCTTCTCCCTAGACCACTCGAGTGGTCTAGGGAGAAGGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017572.2-661s1c1
Sequence:CCGGCCTAGAGCTGATTGAGTTCTTCTCGAGAAGAACTCAATCAGCTCTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017572.2-1540s1c1
Sequence:CCGGCATGTGTTAATGTTACGATGTCTCGAGACATCGTAACATTAACACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_017572.2-465s1c1
Sequence:CCGGGCAGGTTTGAAGACGTCTACCCTCGAGGGTAGACGTCTTCAAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017572.2-1172s1c1
Sequence:CCGGGCCTGCCAGAACATGCTGTTTCTCGAGAAACAGCATGTTCTGGCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017572.2-1075s1c1
Sequence:CCGGCCTGGGCGTCATCTTGTATATCTCGAGATATACAAGATGACGCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017572.3-671s21c1
Sequence:CCGGCCTAGAGCTGATTGAGTTCTTCTCGAGAAGAACTCAATCAGCTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017572.2-1538s1c1
Sequence:CCGGGCCATGTGTTAATGTTACGATCTCGAGATCGTAACATTAACACATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017572.2-565s1c1
Sequence:CCGGCGCCGTCAAGATCATTGAGAACTCGAGTTCTCAATGATCTTGACGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017572
VALIDATED
MKNK2 MISSION shRNA shRNA Plasmid DNA
MAP kinase interacting serine/threonine kinase 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017572.3-475s21c1
Sequence:CCGGGCAGGTTTGAAGACGTCTACCCTCGAGGGTAGACGTCTTCAAACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017572.3-575s21c1
Sequence:CCGGCGCCGTCAAGATCATTGAGAACTCGAGTTCTCAATGATCTTGACGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017572.3-1550s21c1
Sequence:CCGGCATGTGTTAATGTTACGATGTCTCGAGACATCGTAACATTAACACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017572.2-1037s1c1
Sequence:CCGGGAGGCTAGCATCTACGACAAGCTCGAGCTTGTCGTAGATGCTAGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017572.2-534s1c1
Sequence:CCGGCCTGCATCAACCTGATCACCACTCGAGTGGTGATCAGGTTGATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017572.2-304s1c1
Sequence:CCGGGCTGGCCTTCTCCCTAGACCACTCGAGTGGTCTAGGGAGAAGGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017572.2-661s1c1
Sequence:CCGGCCTAGAGCTGATTGAGTTCTTCTCGAGAAGAACTCAATCAGCTCTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017572.2-1540s1c1
Sequence:CCGGCATGTGTTAATGTTACGATGTCTCGAGACATCGTAACATTAACACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_017572.2-465s1c1
Sequence:CCGGGCAGGTTTGAAGACGTCTACCCTCGAGGGTAGACGTCTTCAAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017572.2-1172s1c1
Sequence:CCGGGCCTGCCAGAACATGCTGTTTCTCGAGAAACAGCATGTTCTGGCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017572.2-1075s1c1
Sequence:CCGGCCTGGGCGTCATCTTGTATATCTCGAGATATACAAGATGACGCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017572.3-671s21c1
Sequence:CCGGCCTAGAGCTGATTGAGTTCTTCTCGAGAAGAACTCAATCAGCTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017572.2-1538s1c1
Sequence:CCGGGCCATGTGTTAATGTTACGATCTCGAGATCGTAACATTAACACATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017572.2-565s1c1
Sequence:CCGGCGCCGTCAAGATCATTGAGAACTCGAGTTCTCAATGATCTTGACGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017572
VALIDATED
MKNK2 MISSION shRNA Lentiviral Transduction Particles
MAP kinase interacting serine/threonine kinase 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017572.3-475s21c1
Sequence:CCGGGCAGGTTTGAAGACGTCTACCCTCGAGGGTAGACGTCTTCAAACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017572.3-575s21c1
Sequence:CCGGCGCCGTCAAGATCATTGAGAACTCGAGTTCTCAATGATCTTGACGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017572.3-1550s21c1
Sequence:CCGGCATGTGTTAATGTTACGATGTCTCGAGACATCGTAACATTAACACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017572.2-1037s1c1
Sequence:CCGGGAGGCTAGCATCTACGACAAGCTCGAGCTTGTCGTAGATGCTAGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017572.2-534s1c1
Sequence:CCGGCCTGCATCAACCTGATCACCACTCGAGTGGTGATCAGGTTGATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017572.2-304s1c1
Sequence:CCGGGCTGGCCTTCTCCCTAGACCACTCGAGTGGTCTAGGGAGAAGGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017572.2-661s1c1
Sequence:CCGGCCTAGAGCTGATTGAGTTCTTCTCGAGAAGAACTCAATCAGCTCTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017572.2-1540s1c1
Sequence:CCGGCATGTGTTAATGTTACGATGTCTCGAGACATCGTAACATTAACACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_017572.2-465s1c1
Sequence:CCGGGCAGGTTTGAAGACGTCTACCCTCGAGGGTAGACGTCTTCAAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017572.2-1172s1c1
Sequence:CCGGGCCTGCCAGAACATGCTGTTTCTCGAGAAACAGCATGTTCTGGCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017572.2-1075s1c1
Sequence:CCGGCCTGGGCGTCATCTTGTATATCTCGAGATATACAAGATGACGCCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017572.3-671s21c1
Sequence:CCGGCCTAGAGCTGATTGAGTTCTTCTCGAGAAGAACTCAATCAGCTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017572.2-1538s1c1
Sequence:CCGGGCCATGTGTTAATGTTACGATCTCGAGATCGTAACATTAACACATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017572.2-565s1c1
Sequence:CCGGCGCCGTCAAGATCATTGAGAACTCGAGTTCTCAATGATCTTGACGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021462
VALIDATED
MKNK2 MISSION shRNA Bacterial Glycerol Stock
MAP kinase interacting serine/threonine kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021462.3-367s21c1
Sequence:CCGGGACCGTTTCTACCTGGTGTTTCTCGAGAAACACCAGGTAGAAACGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021462.2-204s1c2
Sequence:CCGGGCAGACCTGTGTCAATCTCATCTCGAGATGAGATTGACACAGGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021462.3-916s21c1
Sequence:CCGGCACATCTCCTTTGCTGCCAAACTCGAGTTTGGCAGCAAAGGAGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021462.3-407s21c1
Sequence:CCGGCCATCCTAAGCCACATCCATACTCGAGTATGGATGTGGCTTAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021462.2-367s1c1
Sequence:CCGGGACCGTTTCTACCTGGTGTTTCTCGAGAAACACCAGGTAGAAACGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021462.2-407s1c1
Sequence:CCGGCCATCCTAAGCCACATCCATACTCGAGTATGGATGTGGCTTAGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021462.2-486s1c1
Sequence:CCGGCCTGGACTTCCTGCATAACAACTCGAGTTGTTATGCAGGAAGTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021462.2-916s1c1
Sequence:CCGGCACATCTCCTTTGCTGCCAAACTCGAGTTTGGCAGCAAAGGAGATGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021462.3-486s21c1
Sequence:CCGGCCTGGACTTCCTGCATAACAACTCGAGTTGTTATGCAGGAAGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021462
VALIDATED
MKNK2 MISSION shRNA shRNA Plasmid DNA
MAP kinase interacting serine/threonine kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021462.3-367s21c1
Sequence:CCGGGACCGTTTCTACCTGGTGTTTCTCGAGAAACACCAGGTAGAAACGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021462.2-204s1c2
Sequence:CCGGGCAGACCTGTGTCAATCTCATCTCGAGATGAGATTGACACAGGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021462.3-916s21c1
Sequence:CCGGCACATCTCCTTTGCTGCCAAACTCGAGTTTGGCAGCAAAGGAGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021462.3-407s21c1
Sequence:CCGGCCATCCTAAGCCACATCCATACTCGAGTATGGATGTGGCTTAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021462.2-367s1c1
Sequence:CCGGGACCGTTTCTACCTGGTGTTTCTCGAGAAACACCAGGTAGAAACGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021462.2-407s1c1
Sequence:CCGGCCATCCTAAGCCACATCCATACTCGAGTATGGATGTGGCTTAGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021462.2-486s1c1
Sequence:CCGGCCTGGACTTCCTGCATAACAACTCGAGTTGTTATGCAGGAAGTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021462.2-916s1c1
Sequence:CCGGCACATCTCCTTTGCTGCCAAACTCGAGTTTGGCAGCAAAGGAGATGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021462.3-486s21c1
Sequence:CCGGCCTGGACTTCCTGCATAACAACTCGAGTTGTTATGCAGGAAGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021462
VALIDATED
MKNK2 MISSION shRNA Lentiviral Transduction Particles
MAP kinase interacting serine/threonine kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021462.3-367s21c1
Sequence:CCGGGACCGTTTCTACCTGGTGTTTCTCGAGAAACACCAGGTAGAAACGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021462.2-204s1c2
Sequence:CCGGGCAGACCTGTGTCAATCTCATCTCGAGATGAGATTGACACAGGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021462.3-916s21c1
Sequence:CCGGCACATCTCCTTTGCTGCCAAACTCGAGTTTGGCAGCAAAGGAGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021462.3-407s21c1
Sequence:CCGGCCATCCTAAGCCACATCCATACTCGAGTATGGATGTGGCTTAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021462.2-367s1c1
Sequence:CCGGGACCGTTTCTACCTGGTGTTTCTCGAGAAACACCAGGTAGAAACGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021462.2-407s1c1
Sequence:CCGGCCATCCTAAGCCACATCCATACTCGAGTATGGATGTGGCTTAGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021462.2-486s1c1
Sequence:CCGGCCTGGACTTCCTGCATAACAACTCGAGTTGTTATGCAGGAAGTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021462.2-916s1c1
Sequence:CCGGCACATCTCCTTTGCTGCCAAACTCGAGTTTGGCAGCAAAGGAGATGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021462.3-486s21c1
Sequence:CCGGCCTGGACTTCCTGCATAACAACTCGAGTTGTTATGCAGGAAGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)