EMAIL THIS PAGE TO A FRIEND

MKRN1

makorin ring finger protein 1

267 Gene Product Result for
Synonyms: RNF61
Gene ID:
Human(23608) Summary: The Makorin ring finger protein-1 gene (MKRN1) is a highly transcribed, intron-containing source for a family of intronless mammalian genes encoding a novel class of zinc finger proteins. Phylogenetic analyses indicate that the MKRN1 gene is the ancestral founder of this gene family (Gray et al., 2000 [PubMed 10843807]
Mouse(54484) makorin, ring finger protein, 1
Rat(296988) makorin ring finger protein 1
Zebrafish(170782) makorin, ring finger protein, 1
fruit fly(44131) Makorin 1
chicken(395500) makorin ring finger protein 1
cow(514986) makorin ring finger protein 1
Horse(100065893) makorin ring finger protein 1
domestic cat(101092096) makorin ring finger protein 1
dog(475528) makorin ring finger protein 1
sheep(100499498) makorin ring finger protein 1
domestic guinea pig(100722285) makorin ring finger protein 1
naked mole-rat(101701379) makorin ring finger protein 1
Domestic Rabbit(100351209) makorin ring finger protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013446 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013446 Rosetta Predictions human pricing
NM_001004233 Rosetta Predictions rat pricing
NM_018810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102105 predicted 1378
2 SASI_Hs01_00102106 predicted 841
3 SASI_Hs01_00102107 predicted 1114
4 SASI_Hs01_00102108 predicted 1145
5 SASI_Hs01_00102109 predicted 651
6 SASI_Hs01_00102110 predicted 761
7 SASI_Hs01_00102112 predicted 1110
8 SASI_Hs01_00102113 predicted 1216
9 SASI_Hs02_00344852 predicted 481
10 SASI_Hs01_00102111 predicted 1482
11 SASI_Hs01_00102114 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086228 predicted 1064
2 SASI_Rn01_00086229 predicted 773
3 SASI_Rn01_00086230 predicted 210
4 SASI_Rn01_00086231 predicted 1186
5 SASI_Rn01_00086232 predicted 1103
6 SASI_Rn01_00086233 predicted 678
7 SASI_Rn02_00198236 predicted 1176
8 SASI_Rn01_00086236 predicted 923
9 SASI_Rn01_00086237 predicted 974
10 SASI_Rn02_00198237 predicted 1097
11 SASI_Rn01_00086234 predicted 963
12 SASI_Rn01_00086235 predicted 1119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049553 predicted 1226
2 SASI_Mm01_00049554 predicted 1311
3 SASI_Mm01_00049555 predicted 1220
4 SASI_Mm01_00049556 predicted 1287
5 SASI_Mm01_00049557 predicted 1412
6 SASI_Mm01_00049558 predicted 548
7 SASI_Mm01_00049559 predicted 1226
8 SASI_Mm01_00049560 predicted 764
9 SASI_Mm01_00049561 predicted 1395
10 SASI_Mm01_00049562 predicted 1180
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018810
VALIDATED
MKRN1 MISSION shRNA Bacterial Glycerol Stock
makorin ring finger protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018810.2-343s21c1
Sequence:CCGGACGGCGTAGTGTGCAAGTATTCTCGAGAATACTTGCACACTACGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018810.1-1038s1c1
Sequence:CCGGCTGTCTCAAGTGTATTCGCAACTCGAGTTGCGAATACACTTGAGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018810.1-1442s1c1
Sequence:CCGGGCGAGATGTTGCTTATGCTTTCTCGAGAAAGCATAAGCAACATCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018810.1-521s1c1
Sequence:CCGGGTGTTGGATCACTTGCTGAAACTCGAGTTTCAGCAAGTGATCCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018810.1-861s1c1
Sequence:CCGGCCAGAGGTCACAGCACATAAACTCGAGTTTATGTGCTGTGACCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018810.2-496s21c1
Sequence:CCGGGTGTTGGATCACTTGCTGAAACTCGAGTTTCAGCAAGTGATCCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018810.1-1504s1c1
Sequence:CCGGGAGTGGGACTTGTTTCACGATCTCGAGATCGTGAAACAAGTCCCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018810.2-1087s21c1
Sequence:CCGGGCCGGATCACATCTAACTTTGCTCGAGCAAAGTTAGATGTGATCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018810.2-1996s21c1
Sequence:CCGGAGCTGTTCCCTGCCCTGTAATCTCGAGATTACAGGGCAGGGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018810.2-1184s21c1
Sequence:CCGGCAACAAGGCGTGCAGGTATTTCTCGAGAAATACCTGCACGCCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018810
VALIDATED
MKRN1 MISSION shRNA shRNA Plasmid DNA
makorin ring finger protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018810.2-343s21c1
Sequence:CCGGACGGCGTAGTGTGCAAGTATTCTCGAGAATACTTGCACACTACGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018810.1-1038s1c1
Sequence:CCGGCTGTCTCAAGTGTATTCGCAACTCGAGTTGCGAATACACTTGAGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018810.1-1442s1c1
Sequence:CCGGGCGAGATGTTGCTTATGCTTTCTCGAGAAAGCATAAGCAACATCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018810.1-521s1c1
Sequence:CCGGGTGTTGGATCACTTGCTGAAACTCGAGTTTCAGCAAGTGATCCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018810.1-861s1c1
Sequence:CCGGCCAGAGGTCACAGCACATAAACTCGAGTTTATGTGCTGTGACCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018810.2-496s21c1
Sequence:CCGGGTGTTGGATCACTTGCTGAAACTCGAGTTTCAGCAAGTGATCCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018810.1-1504s1c1
Sequence:CCGGGAGTGGGACTTGTTTCACGATCTCGAGATCGTGAAACAAGTCCCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018810.2-1087s21c1
Sequence:CCGGGCCGGATCACATCTAACTTTGCTCGAGCAAAGTTAGATGTGATCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018810.2-1996s21c1
Sequence:CCGGAGCTGTTCCCTGCCCTGTAATCTCGAGATTACAGGGCAGGGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018810.2-1184s21c1
Sequence:CCGGCAACAAGGCGTGCAGGTATTTCTCGAGAAATACCTGCACGCCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018810
VALIDATED
MKRN1 MISSION shRNA Lentiviral Transduction Particles
makorin ring finger protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018810.2-343s21c1
Sequence:CCGGACGGCGTAGTGTGCAAGTATTCTCGAGAATACTTGCACACTACGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018810.1-1038s1c1
Sequence:CCGGCTGTCTCAAGTGTATTCGCAACTCGAGTTGCGAATACACTTGAGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018810.1-1442s1c1
Sequence:CCGGGCGAGATGTTGCTTATGCTTTCTCGAGAAAGCATAAGCAACATCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018810.1-521s1c1
Sequence:CCGGGTGTTGGATCACTTGCTGAAACTCGAGTTTCAGCAAGTGATCCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018810.1-861s1c1
Sequence:CCGGCCAGAGGTCACAGCACATAAACTCGAGTTTATGTGCTGTGACCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018810.2-496s21c1
Sequence:CCGGGTGTTGGATCACTTGCTGAAACTCGAGTTTCAGCAAGTGATCCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018810.1-1504s1c1
Sequence:CCGGGAGTGGGACTTGTTTCACGATCTCGAGATCGTGAAACAAGTCCCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018810.2-1087s21c1
Sequence:CCGGGCCGGATCACATCTAACTTTGCTCGAGCAAAGTTAGATGTGATCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018810.2-1996s21c1
Sequence:CCGGAGCTGTTCCCTGCCCTGTAATCTCGAGATTACAGGGCAGGGAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018810.2-1184s21c1
Sequence:CCGGCAACAAGGCGTGCAGGTATTTCTCGAGAAATACCTGCACGCCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013446
VALIDATED
MKRN1 MISSION shRNA Bacterial Glycerol Stock
makorin ring finger protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013446.3-617s21c1
Sequence:CCGGCCTCAAGTCTCTCATCGATAGCTCGAGCTATCGATGAGAGACTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013446.2-917s1c1
Sequence:CCGGGCAGCATATCAAATCGTGCATCTCGAGATGCACGATTTGATATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013446.2-1449s1c1
Sequence:CCGGCCCTTTGACAACGATGAAGAACTCGAGTTCTTCATCGTTGTCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013446.2-397s1c1
Sequence:CCGGACCTCTCTGACAGTCCGTATACTCGAGTATACGGACTGTCAGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013446.2-851s1c1
Sequence:CCGGCCACGGAGATTCTTGTGACATCTCGAGATGTCACAAGAATCTCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013446.2-412s1c1
Sequence:CCGGCGTATAGTGTAGTGTGCAAGTCTCGAGACTTGCACACTACACTATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013446.3-479s21c1
Sequence:CCGGCGTATAGTGTAGTGTGCAAGTCTCGAGACTTGCACACTACACTATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013446.3-918s21c1
Sequence:CCGGCCACGGAGATTCTTGTGACATCTCGAGATGTCACAAGAATCTCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013446.3-464s21c1
Sequence:CCGGACCTCTCTGACAGTCCGTATACTCGAGTATACGGACTGTCAGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013446.3-1957s21c1
Sequence:CCGGTTCAACCAGATTGCATTTATGCTCGAGCATAAATGCAATCTGGTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013446
VALIDATED
MKRN1 MISSION shRNA shRNA Plasmid DNA
makorin ring finger protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013446.3-617s21c1
Sequence:CCGGCCTCAAGTCTCTCATCGATAGCTCGAGCTATCGATGAGAGACTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013446.2-917s1c1
Sequence:CCGGGCAGCATATCAAATCGTGCATCTCGAGATGCACGATTTGATATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013446.2-1449s1c1
Sequence:CCGGCCCTTTGACAACGATGAAGAACTCGAGTTCTTCATCGTTGTCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013446.2-397s1c1
Sequence:CCGGACCTCTCTGACAGTCCGTATACTCGAGTATACGGACTGTCAGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013446.2-851s1c1
Sequence:CCGGCCACGGAGATTCTTGTGACATCTCGAGATGTCACAAGAATCTCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013446.2-412s1c1
Sequence:CCGGCGTATAGTGTAGTGTGCAAGTCTCGAGACTTGCACACTACACTATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013446.3-479s21c1
Sequence:CCGGCGTATAGTGTAGTGTGCAAGTCTCGAGACTTGCACACTACACTATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013446.3-918s21c1
Sequence:CCGGCCACGGAGATTCTTGTGACATCTCGAGATGTCACAAGAATCTCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013446.3-464s21c1
Sequence:CCGGACCTCTCTGACAGTCCGTATACTCGAGTATACGGACTGTCAGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013446.3-1957s21c1
Sequence:CCGGTTCAACCAGATTGCATTTATGCTCGAGCATAAATGCAATCTGGTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013446
VALIDATED
MKRN1 MISSION shRNA Lentiviral Transduction Particles
makorin ring finger protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013446.3-617s21c1
Sequence:CCGGCCTCAAGTCTCTCATCGATAGCTCGAGCTATCGATGAGAGACTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013446.2-917s1c1
Sequence:CCGGGCAGCATATCAAATCGTGCATCTCGAGATGCACGATTTGATATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013446.2-1449s1c1
Sequence:CCGGCCCTTTGACAACGATGAAGAACTCGAGTTCTTCATCGTTGTCAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013446.2-397s1c1
Sequence:CCGGACCTCTCTGACAGTCCGTATACTCGAGTATACGGACTGTCAGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013446.2-851s1c1
Sequence:CCGGCCACGGAGATTCTTGTGACATCTCGAGATGTCACAAGAATCTCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013446.2-412s1c1
Sequence:CCGGCGTATAGTGTAGTGTGCAAGTCTCGAGACTTGCACACTACACTATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013446.3-479s21c1
Sequence:CCGGCGTATAGTGTAGTGTGCAAGTCTCGAGACTTGCACACTACACTATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013446.3-918s21c1
Sequence:CCGGCCACGGAGATTCTTGTGACATCTCGAGATGTCACAAGAATCTCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013446.3-464s21c1
Sequence:CCGGACCTCTCTGACAGTCCGTATACTCGAGTATACGGACTGTCAGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013446.3-1957s21c1
Sequence:CCGGTTCAACCAGATTGCATTTATGCTCGAGCATAAATGCAATCTGGTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)