EMAIL THIS PAGE TO A FRIEND

MKRN3

makorin ring finger protein 3

97 Gene Product Result for
Synonyms: CPPB2 D15S9 RNF63 ZFP127 ZNF127
UniProtKB ID: Q13064
Gene ID:
Human(7681) Summary: The protein encoded by this gene contains a RING (C3HC4) zinc finger motif and several C3H zinc finger motifs. This gene is intronless and imprinted, with expression only from the paternal allele. Disruption of the imprinting at this locus may contribute to Prader-Willi syndrome. An antisense RNA of unknown function has been found overlapping this gene. [provided by RefSeq, Jul 2008]
Mouse(22652) makorin, ring finger protein, 3
Rat(292988) makorin, ring finger protein, 3
chicken(419892) makorin ring finger protein 3
domestic cat(101088413) makorin ring finger protein 3
cow(517464) makorin ring finger protein 3
domestic guinea pig(100720902) makorin ring finger protein 3
naked mole-rat(101720194) makorin ring finger protein 3
sheep(101107474) makorin ring finger protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011746 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011746 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011746 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005664 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005664 Rosetta Predictions human pricing
XM_001057262 Rosetta Predictions rat pricing
XM_218735 Rosetta Predictions rat pricing
NM_011746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053038 predicted 751
2 SASI_Hs01_00053039 predicted 1623
3 SASI_Hs01_00053040 predicted 766
4 SASI_Hs01_00053041 predicted 1481
5 SASI_Hs01_00053042 predicted 1519
6 SASI_Hs01_00053043 predicted 1707
7 SASI_Hs01_00053044 predicted 1241
8 SASI_Hs01_00053045 predicted 778
9 SASI_Hs01_00053046 predicted 753
10 SASI_Hs01_00053047 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285845 predicted 1294
2 SASI_Rn02_00285846 predicted 1173
3 SASI_Rn02_00285847 predicted 916
4 SASI_Rn02_00285848 predicted 531
5 SASI_Rn02_00285849 predicted 1476
6 SASI_Rn02_00285850 predicted 1108
7 SASI_Rn02_00285851 predicted 1392
8 SASI_Rn02_00285852 predicted 1426
9 SASI_Rn02_00285853 predicted 223
10 SASI_Rn02_00285854 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378003 predicted 1288
2 SASI_Rn02_00378004 predicted 1179
3 SASI_Rn02_00378005 predicted 922
4 SASI_Rn02_00378006 predicted 528
5 SASI_Rn02_00378007 predicted 1475
6 SASI_Rn02_00378008 predicted 1107
7 SASI_Rn02_00378009 predicted 1398
8 SASI_Rn02_00378010 predicted 1433
9 SASI_Rn02_00378011 predicted 215
10 SASI_Rn02_00378012 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070988 predicted 1249
2 SASI_Mm01_00070989 predicted 1714
3 SASI_Mm01_00070990 predicted 1433
4 SASI_Mm01_00070991 predicted 1771
5 SASI_Mm01_00070992 predicted 1356
6 SASI_Mm01_00070993 predicted 1210
7 SASI_Mm01_00070995 predicted 1392
8 SASI_Mm01_00070996 predicted 1885
9 SASI_Mm01_00070997 predicted 1121
10 SASI_Mm02_00321327 predicted 1713
11 SASI_Mm01_00070994 predicted 1434
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011746
MKRN3 MISSION shRNA Bacterial Glycerol Stock
makorin ring finger protein 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011746.2-2208s21c1
Sequence:CCGGTGTTAACTTGTGGTTACTTTGCTCGAGCAAAGTAACCACAAGTTAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011746.1-1006s1c1
Sequence:CCGGCCATGGAGAAATATGCGACATCTCGAGATGTCGCATATTTCTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011746.1-1720s1c1
Sequence:CCGGGCTGGAAGAATATTTCAGTTTCTCGAGAAACTGAAATATTCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011746.1-852s1c1
Sequence:CCGGCGGCAATTGAGAGAGAGCATACTCGAGTATGCTCTCTCTCAATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011746.1-1279s1c1
Sequence:CCGGGTTTGAGAACAGGATCAGTAACTCGAGTTACTGATCCTGTTCTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011746.2-1566s21c1
Sequence:CCGGGAGGGAAACGTGCTGTTTAAACTCGAGTTTAAACAGCACGTTTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011746.2-1394s21c1
Sequence:CCGGCCAGAAAGCGTGCAGGTATTTCTCGAGAAATACCTGCACGCTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011746.2-2011s21c1
Sequence:CCGGTCACTTCTAGTCTAGTGTTTACTCGAGTAAACACTAGACTAGAAGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011746
MKRN3 MISSION shRNA shRNA Plasmid DNA
makorin ring finger protein 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011746.2-2208s21c1
Sequence:CCGGTGTTAACTTGTGGTTACTTTGCTCGAGCAAAGTAACCACAAGTTAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011746.1-1006s1c1
Sequence:CCGGCCATGGAGAAATATGCGACATCTCGAGATGTCGCATATTTCTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011746.1-1720s1c1
Sequence:CCGGGCTGGAAGAATATTTCAGTTTCTCGAGAAACTGAAATATTCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011746.1-852s1c1
Sequence:CCGGCGGCAATTGAGAGAGAGCATACTCGAGTATGCTCTCTCTCAATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011746.1-1279s1c1
Sequence:CCGGGTTTGAGAACAGGATCAGTAACTCGAGTTACTGATCCTGTTCTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011746.2-1566s21c1
Sequence:CCGGGAGGGAAACGTGCTGTTTAAACTCGAGTTTAAACAGCACGTTTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011746.2-1394s21c1
Sequence:CCGGCCAGAAAGCGTGCAGGTATTTCTCGAGAAATACCTGCACGCTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011746.2-2011s21c1
Sequence:CCGGTCACTTCTAGTCTAGTGTTTACTCGAGTAAACACTAGACTAGAAGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011746
MKRN3 MISSION shRNA Lentiviral Transduction Particles
makorin ring finger protein 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011746.2-2208s21c1
Sequence:CCGGTGTTAACTTGTGGTTACTTTGCTCGAGCAAAGTAACCACAAGTTAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011746.1-1006s1c1
Sequence:CCGGCCATGGAGAAATATGCGACATCTCGAGATGTCGCATATTTCTCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011746.1-1720s1c1
Sequence:CCGGGCTGGAAGAATATTTCAGTTTCTCGAGAAACTGAAATATTCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011746.1-852s1c1
Sequence:CCGGCGGCAATTGAGAGAGAGCATACTCGAGTATGCTCTCTCTCAATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011746.1-1279s1c1
Sequence:CCGGGTTTGAGAACAGGATCAGTAACTCGAGTTACTGATCCTGTTCTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011746.2-1566s21c1
Sequence:CCGGGAGGGAAACGTGCTGTTTAAACTCGAGTTTAAACAGCACGTTTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011746.2-1394s21c1
Sequence:CCGGCCAGAAAGCGTGCAGGTATTTCTCGAGAAATACCTGCACGCTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011746.2-2011s21c1
Sequence:CCGGTCACTTCTAGTCTAGTGTTTACTCGAGTAAACACTAGACTAGAAGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005664
MKRN3 MISSION shRNA Bacterial Glycerol Stock
makorin ring finger protein 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005664.3-1833s21c1
Sequence:CCGGGAGGGCAACATGCTCTATAAACTCGAGTTTATAGAGCATGTTGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005664.1-1092s1c1
Sequence:CCGGGCTTTGGCATTCTTTCCAATTCTCGAGAATTGGAAAGAATGCCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005664.1-400s1c1
Sequence:CCGGGCAGATCATCTGCAGGTATTACTCGAGTAATACCTGCAGATGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005664.1-1538s1c1
Sequence:CCGGCGGTTTCTTTCACTGAGAGATCTCGAGATCTCTCAGTGAAAGAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005664.1-1340s1c1
Sequence:CCGGCCATTTGGAGACACATGCTTTCTCGAGAAAGCATGTGTCTCCAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005664.1-892s1c1
Sequence:CCGGCCATGGAGACATATGCGACATCTCGAGATGTCGCATATGTCTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005664.3-1342s21c1
Sequence:CCGGGCATTGAAGCACACGAGAAAGCTCGAGCTTTCTCGTGTGCTTCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005664
MKRN3 MISSION shRNA shRNA Plasmid DNA
makorin ring finger protein 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005664.3-1833s21c1
Sequence:CCGGGAGGGCAACATGCTCTATAAACTCGAGTTTATAGAGCATGTTGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005664.1-1092s1c1
Sequence:CCGGGCTTTGGCATTCTTTCCAATTCTCGAGAATTGGAAAGAATGCCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005664.1-400s1c1
Sequence:CCGGGCAGATCATCTGCAGGTATTACTCGAGTAATACCTGCAGATGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005664.1-1538s1c1
Sequence:CCGGCGGTTTCTTTCACTGAGAGATCTCGAGATCTCTCAGTGAAAGAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005664.1-1340s1c1
Sequence:CCGGCCATTTGGAGACACATGCTTTCTCGAGAAAGCATGTGTCTCCAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005664.1-892s1c1
Sequence:CCGGCCATGGAGACATATGCGACATCTCGAGATGTCGCATATGTCTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005664.3-1342s21c1
Sequence:CCGGGCATTGAAGCACACGAGAAAGCTCGAGCTTTCTCGTGTGCTTCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005664
MKRN3 MISSION shRNA Lentiviral Transduction Particles
makorin ring finger protein 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005664.3-1833s21c1
Sequence:CCGGGAGGGCAACATGCTCTATAAACTCGAGTTTATAGAGCATGTTGCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005664.1-1092s1c1
Sequence:CCGGGCTTTGGCATTCTTTCCAATTCTCGAGAATTGGAAAGAATGCCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005664.1-400s1c1
Sequence:CCGGGCAGATCATCTGCAGGTATTACTCGAGTAATACCTGCAGATGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005664.1-1538s1c1
Sequence:CCGGCGGTTTCTTTCACTGAGAGATCTCGAGATCTCTCAGTGAAAGAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005664.1-1340s1c1
Sequence:CCGGCCATTTGGAGACACATGCTTTCTCGAGAAAGCATGTGTCTCCAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005664.1-892s1c1
Sequence:CCGGCCATGGAGACATATGCGACATCTCGAGATGTCGCATATGTCTCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005664.3-1342s21c1
Sequence:CCGGGCATTGAAGCACACGAGAAAGCTCGAGCTTTCTCGTGTGCTTCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)