EMAIL THIS PAGE TO A FRIEND

MKRN4P

makorin ring finger protein 4, pseudogene

Gene Product Result for
Synonyms: MKRN4 MKRNP5 RNF64 ZNF-Xp ZNF127-Xp ZNF127L1
Species: Human MKRN4P(7682)
UniProtKB ID: Q13434
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030757
MKRN4P MISSION shRNA Bacterial Glycerol Stock
makorin ring finger protein 4, pseudogene
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000033723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030757.1-608s1c1
Sequence:CCGGGCTGGACTAAACAGGTCACTTCTCGAGAAGTGACCTGTTTAGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030757.1-1683s1c1
Sequence:CCGGAGGCCAACAAAGGAACCACTTCTCGAGAAGTGGTTCCTTTGTTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030757.1-1210s1c1
Sequence:CCGGCATATACAAGCGTGCATTGAACTCGAGTTCAATGCACGCTTGTATATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030757.1-1501s1c1
Sequence:CCGGGAAGAGAAGCAGAAACTCATTCTCGAGAATGAGTTTCTGCTTCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030757
MKRN4P MISSION shRNA shRNA Plasmid DNA
makorin ring finger protein 4, pseudogene
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000033723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030757.1-608s1c1
Sequence:CCGGGCTGGACTAAACAGGTCACTTCTCGAGAAGTGACCTGTTTAGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030757.1-1683s1c1
Sequence:CCGGAGGCCAACAAAGGAACCACTTCTCGAGAAGTGGTTCCTTTGTTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030757.1-1210s1c1
Sequence:CCGGCATATACAAGCGTGCATTGAACTCGAGTTCAATGCACGCTTGTATATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030757.1-1501s1c1
Sequence:CCGGGAAGAGAAGCAGAAACTCATTCTCGAGAATGAGTTTCTGCTTCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030757
MKRN4P MISSION shRNA Lentiviral Transduction Particles
makorin ring finger protein 4, pseudogene
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000033723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030757.1-608s1c1
Sequence:CCGGGCTGGACTAAACAGGTCACTTCTCGAGAAGTGACCTGTTTAGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030757.1-1683s1c1
Sequence:CCGGAGGCCAACAAAGGAACCACTTCTCGAGAAGTGGTTCCTTTGTTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030757.1-1210s1c1
Sequence:CCGGCATATACAAGCGTGCATTGAACTCGAGTTCAATGCACGCTTGTATATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030757.1-1501s1c1
Sequence:CCGGGAAGAGAAGCAGAAACTCATTCTCGAGAATGAGTTTCTGCTTCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)