EMAIL THIS PAGE TO A FRIEND

MKS1

Meckel syndrome, type 1

89 Gene Product Result for
Synonyms: BBS13 MES MKS POC12
UniProtKB ID: Q9NXB0, B7WNX4, F5H885, Q284T0, Q96G13
Gene ID:
Human(54903) Summary: The protein encoded by this gene localizes to the basal body and is required for formation of the primary cilium in ciliated epithelial cells. Mutations in this gene result in Meckel syndrome type 1 and in Bardet-Biedl syndrome type 13. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(380718) Meckel syndrome, type 1
Rat(287612) Meckel syndrome, type 1
Zebrafish(556706) Meckel syndrome, type 1
Horse(100056833) Meckel syndrome, type 1
cow(530761) Meckel syndrome, type 1
domestic cat(101097932) Meckel syndrome, type 1
chicken(417457) Meckel syndrome, type 1
dog(491110) Meckel syndrome, type 1
Thale Cress(821400) MAP kinase substrate 1
sheep(101104588) Meckel syndrome, type 1
naked mole-rat(101706375) Meckel syndrome, type 1
domestic guinea pig(100726103) Meckel syndrome, type 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017777 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017777 Rosetta Predictions human pricing
NM_001034917 Rosetta Predictions rat pricing
NM_001039684 Rosetta Predictions mouse pricing
XM_001005476 Rosetta Predictions mouse pricing
XM_001005478 Rosetta Predictions mouse pricing
XM_001005479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037339 predicted 751
2 SASI_Hs01_00037340 predicted 1567
3 SASI_Hs01_00037341 predicted 223
4 SASI_Hs01_00037343 predicted 302
5 SASI_Hs01_00037344 predicted 855
6 SASI_Hs01_00037345 predicted 720
7 SASI_Hs01_00037346 predicted 457
8 SASI_Hs01_00037347 predicted 915
9 SASI_Hs01_00037348 predicted 1042
10 SASI_Hs02_00350616 predicted 1027
11 SASI_Hs01_00037342 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034917 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080607 predicted 1336
2 SASI_Rn01_00080608 predicted 1104
3 SASI_Rn01_00080609 predicted 1763
4 SASI_Rn01_00080610 predicted 1095
5 SASI_Rn01_00080611 predicted 370
6 SASI_Rn02_00204056 predicted 1732
7 SASI_Rn01_00080612 predicted 385
8 SASI_Rn01_00080613 predicted 525
9 SASI_Rn01_00080614 predicted 848
10 SASI_Rn01_00080615 predicted 778
11 SASI_Rn01_00080606 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045692 predicted 800
2 SASI_Mm01_00045693 predicted 363
3 SASI_Mm01_00045694 predicted 1799
4 SASI_Mm01_00045695 predicted 1135
5 SASI_Mm01_00045696 predicted 1357
6 SASI_Mm01_00045697 predicted 252
7 SASI_Mm01_00045700 predicted 632
8 SASI_Mm01_00045701 predicted 1532
9 SASI_Mm02_00290207 predicted 604
10 SASI_Mm02_00290208 predicted 881
11 SASI_Mm01_00045698 predicted 637
12 SASI_Mm01_00045699 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252484 predicted 1076
2 SASI_Mm01_00252485 predicted 365
3 SASI_Mm01_00252486 predicted 971
4 SASI_Mm01_00252487 predicted 220
5 SASI_Mm01_00252488 predicted 627
6 SASI_Mm01_00252489 predicted 860
7 SASI_Mm01_00252490 predicted 595
8 SASI_Mm01_00252491 predicted 573
9 SASI_Mm01_00252492 predicted 640
10 SASI_Mm01_00252493 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260783 predicted 382
2 SASI_Mm01_00260784 predicted 418
3 SASI_Mm01_00260785 predicted 247
4 SASI_Mm01_00260786 predicted 262
5 SASI_Mm01_00260787 predicted 671
6 SASI_Mm01_00260788 predicted 305
7 SASI_Mm01_00260789 predicted 645
8 SASI_Mm01_00260790 predicted 619
9 SASI_Mm01_00260791 predicted 683
10 SASI_Mm01_00260792 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205164 predicted 816
2 SASI_Mm01_00205165 predicted 1808
3 SASI_Mm01_00205166 predicted 1154
4 SASI_Mm01_00205167 predicted 1371
5 SASI_Mm01_00205168 predicted 672
6 SASI_Mm01_00205169 predicted 1122
7 SASI_Mm01_00205170 predicted 1543
8 SASI_Mm01_00205171 predicted 1153
9 SASI_Mm01_00205172 predicted 996
10 SASI_Mm01_00205173 predicted 898
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039684
MKS1 MISSION shRNA Bacterial Glycerol Stock
Meckel syndrome, type 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039684.2-1932s21c1
Sequence:CCGGTATCAAACACGGGCATCATAACTCGAGTTATGATGCCCGTGTTTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039684.2-662s21c1
Sequence:CCGGTATGGAAAGCTTGGCTATAAGCTCGAGCTTATAGCCAAGCTTTCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039684.2-598s21c1
Sequence:CCGGCAAGAACAACCACGCTATTAACTCGAGTTAATAGCGTGGTTGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039684.2-1127s21c1
Sequence:CCGGATGGACAAGGTGGCCTATTTCCTCGAGGAAATAGGCCACCTTGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039684.2-744s21c1
Sequence:CCGGCTGACTTCACCGGCATCAAAGCTCGAGCTTTGATGCCGGTGAAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039684
MKS1 MISSION shRNA shRNA Plasmid DNA
Meckel syndrome, type 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039684.2-1932s21c1
Sequence:CCGGTATCAAACACGGGCATCATAACTCGAGTTATGATGCCCGTGTTTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039684.2-662s21c1
Sequence:CCGGTATGGAAAGCTTGGCTATAAGCTCGAGCTTATAGCCAAGCTTTCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039684.2-598s21c1
Sequence:CCGGCAAGAACAACCACGCTATTAACTCGAGTTAATAGCGTGGTTGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039684.2-1127s21c1
Sequence:CCGGATGGACAAGGTGGCCTATTTCCTCGAGGAAATAGGCCACCTTGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039684.2-744s21c1
Sequence:CCGGCTGACTTCACCGGCATCAAAGCTCGAGCTTTGATGCCGGTGAAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039684
MKS1 MISSION shRNA Lentiviral Transduction Particles
Meckel syndrome, type 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039684.2-1932s21c1
Sequence:CCGGTATCAAACACGGGCATCATAACTCGAGTTATGATGCCCGTGTTTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039684.2-662s21c1
Sequence:CCGGTATGGAAAGCTTGGCTATAAGCTCGAGCTTATAGCCAAGCTTTCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039684.2-598s21c1
Sequence:CCGGCAAGAACAACCACGCTATTAACTCGAGTTAATAGCGTGGTTGTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039684.2-1127s21c1
Sequence:CCGGATGGACAAGGTGGCCTATTTCCTCGAGGAAATAGGCCACCTTGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039684.2-744s21c1
Sequence:CCGGCTGACTTCACCGGCATCAAAGCTCGAGCTTTGATGCCGGTGAAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017777
VALIDATED
MKS1 MISSION shRNA Bacterial Glycerol Stock
Meckel syndrome, type 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017777.1-1117s1c1
Sequence:CCGGGACCTCTCCTATGTACGGATACTCGAGTATCCGTACATAGGAGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017777.1-1802s1c1
Sequence:CCGGCCTTTCATCTTCCAAGACCAACTCGAGTTGGTCTTGGAAGATGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017777.1-711s1c1
Sequence:CCGGCCAAGGCTATGAGTATGACAACTCGAGTTGTCATACTCATAGCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017777.1-316s1c1
Sequence:CCGGGTCAGGAACAACCACGTCATTCTCGAGAATGACGTGGTTGTTCCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017777.1-1919s1c1
Sequence:CCGGGCTGAGGTTGAGATATGAGTTCTCGAGAACTCATATCTCAACCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017777.1-450s1c1
Sequence:CCGGGATCACAGTAAAGCCTGACTTCTCGAGAAGTCAGGCTTTACTGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017777.1-681s1c1
Sequence:CCGGGCTCTTTGTAAATGGAGAGGTCTCGAGACCTCTCCATTTACAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017777.1-1306s1c1
Sequence:CCGGCAGCAGAGTTCCATTCACAATCTCGAGATTGTGAATGGAACTCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017777.1-525s1c1
Sequence:CCGGGTGGAAATATACGATCGACAACTCGAGTTGTCGATCGTATATTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017777
VALIDATED
MKS1 MISSION shRNA shRNA Plasmid DNA
Meckel syndrome, type 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017777.1-1117s1c1
Sequence:CCGGGACCTCTCCTATGTACGGATACTCGAGTATCCGTACATAGGAGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017777.1-1802s1c1
Sequence:CCGGCCTTTCATCTTCCAAGACCAACTCGAGTTGGTCTTGGAAGATGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017777.1-711s1c1
Sequence:CCGGCCAAGGCTATGAGTATGACAACTCGAGTTGTCATACTCATAGCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017777.1-316s1c1
Sequence:CCGGGTCAGGAACAACCACGTCATTCTCGAGAATGACGTGGTTGTTCCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017777.1-1919s1c1
Sequence:CCGGGCTGAGGTTGAGATATGAGTTCTCGAGAACTCATATCTCAACCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017777.1-450s1c1
Sequence:CCGGGATCACAGTAAAGCCTGACTTCTCGAGAAGTCAGGCTTTACTGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017777.1-681s1c1
Sequence:CCGGGCTCTTTGTAAATGGAGAGGTCTCGAGACCTCTCCATTTACAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017777.1-1306s1c1
Sequence:CCGGCAGCAGAGTTCCATTCACAATCTCGAGATTGTGAATGGAACTCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017777.1-525s1c1
Sequence:CCGGGTGGAAATATACGATCGACAACTCGAGTTGTCGATCGTATATTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017777
VALIDATED
MKS1 MISSION shRNA Lentiviral Transduction Particles
Meckel syndrome, type 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017777.1-1117s1c1
Sequence:CCGGGACCTCTCCTATGTACGGATACTCGAGTATCCGTACATAGGAGAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017777.1-1802s1c1
Sequence:CCGGCCTTTCATCTTCCAAGACCAACTCGAGTTGGTCTTGGAAGATGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017777.1-711s1c1
Sequence:CCGGCCAAGGCTATGAGTATGACAACTCGAGTTGTCATACTCATAGCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017777.1-316s1c1
Sequence:CCGGGTCAGGAACAACCACGTCATTCTCGAGAATGACGTGGTTGTTCCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017777.1-1919s1c1
Sequence:CCGGGCTGAGGTTGAGATATGAGTTCTCGAGAACTCATATCTCAACCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017777.1-450s1c1
Sequence:CCGGGATCACAGTAAAGCCTGACTTCTCGAGAAGTCAGGCTTTACTGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017777.1-681s1c1
Sequence:CCGGGCTCTTTGTAAATGGAGAGGTCTCGAGACCTCTCCATTTACAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017777.1-1306s1c1
Sequence:CCGGCAGCAGAGTTCCATTCACAATCTCGAGATTGTGAATGGAACTCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017777.1-525s1c1
Sequence:CCGGGTGGAAATATACGATCGACAACTCGAGTTGTCGATCGTATATTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)