EMAIL THIS PAGE TO A FRIEND

MKX

mohawk homeobox

212 Gene Product Result for
Synonyms: C10orf48 IFRX IRXL1
UniProtKB ID: Q8IYA7, B3KWM5
Gene ID:
Human(283078) Summary: The protein encoded by this gene is an IRX family-related homeobox protein that may play a role in cell adhesion. Studies in mice suggest that this protein may be a regulator of tendon development. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jun 2011]
Mouse(210719) mohawk homeobox
Rat(291228) mohawk homeobox
chicken(771284) mohawk homeobox
domestic cat(101088584) mohawk homeobox
cow(521239) mohawk homeobox
dog(487079) mohawk homeobox
naked mole-rat(101698701) mohawk homeobox
sheep(101120262) mohawk homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32574 Anti-MKX (AB1) antibody produced in rabbit affinity isolated antibody mouse, human, rat, zebrafish, horse, guinea pig, bovine, canine, rabbit
immunohistochemistry, western blot pricing
AV31887 Anti-MKX (AB2) antibody produced in rabbit affinity isolated antibody guinea pig, zebrafish, human, horse, canine, rat, rabbit, bovine, mouse
western blot pricing
HPA006927 Anti-MKX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV37938 Anti-MKX antibody produced in rabbit IgG fraction of antiserum canine, human, rat, horse, guinea pig, rabbit, bovine, zebrafish, mouse
western blot pricing
SAB2106494 Anti-MKX antibody produced in rabbit affinity isolated antibody rabbit, human, guinea pig, mouse, horse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173576 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010311 MISSION® esiRNA esiRNA targeting human MKX (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173576 Rosetta Predictions human pricing
XM_001063892 Rosetta Predictions rat pricing
XM_214497 Rosetta Predictions rat pricing
NM_177595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198409 predicted 958
2 SASI_Hs01_00198410 predicted 1110
3 SASI_Hs01_00198411 predicted 1088
4 SASI_Hs01_00198412 predicted 701
5 SASI_Hs01_00198413 predicted 920
6 SASI_Hs01_00198414 predicted 1193
7 SASI_Hs01_00198415 predicted 962
8 SASI_Hs01_00198416 predicted 1005
9 SASI_Hs01_00198417 predicted 961
10 SASI_Hs01_00198418 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308642 predicted 1098
2 SASI_Rn02_00308643 predicted 809
3 SASI_Rn02_00308644 predicted 305
4 SASI_Rn02_00308645 predicted 648
5 SASI_Rn02_00308646 predicted 1258
6 SASI_Rn02_00308647 predicted 1040
7 SASI_Rn02_00308648 predicted 793
8 SASI_Rn02_00308649 predicted 1232
9 SASI_Rn02_00308650 predicted 680
10 SASI_Rn02_00308651 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375355 predicted 389
2 SASI_Rn02_00375356 predicted 259
3 SASI_Rn02_00375357 predicted 385
4 SASI_Rn02_00375358 predicted 305
5 SASI_Rn02_00375359 predicted 397
6 SASI_Rn02_00375360 predicted 234
7 SASI_Rn02_00375361 predicted 203
8 SASI_Rn02_00375362 predicted 409
9 SASI_Rn02_00375363 predicted 290
10 SASI_Rn02_00375364 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347773 predicted 652
2 SASI_Mm01_00158409 predicted 1083
3 SASI_Mm01_00158410 predicted 466
4 SASI_Mm01_00158411 predicted 1052
5 SASI_Mm01_00158412 predicted 916
6 SASI_Mm01_00158413 predicted 633
7 SASI_Mm01_00158414 predicted 754
8 SASI_Mm01_00158415 predicted 507
9 SASI_Mm02_00347774 predicted 562
10 SASI_Mm01_00158416 predicted 484
11 SASI_Mm01_00158417 predicted 882
12 SASI_Mm01_00158418 predicted 414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173576
MKX MISSION shRNA Bacterial Glycerol Stock
mohawk homeobox
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173576.2-591s21c1
Sequence:CCGGTAATGCAAGACGTCGGCTTAACTCGAGTTAAGCCGACGTCTTGCATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173576.2-1616s21c1
Sequence:CCGGATTAGCCTGTGTGCATCATTCCTCGAGGAATGATGCACACAGGCTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173576.2-1536s21c1
Sequence:CCGGGTGCCTTGCTTCCCGACAATACTCGAGTATTGTCGGGAAGCAAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173576.2-781s21c1
Sequence:CCGGGTTCACCATCCTGTGATTAAACTCGAGTTTAATCACAGGATGGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173576.1-593s1c1
Sequence:CCGGGCCAGATTTAAGCTGGGCTTTCTCGAGAAAGCCCAGCTTAAATCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173576.1-443s1c1
Sequence:CCGGCCTCAAGCAGTGGCTTTACAACTCGAGTTGTAAAGCCACTGCTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173576.1-1195s1c1
Sequence:CCGGCGTCCCATATAGCAGAAGTAACTCGAGTTACTTCTGCTATATGGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173576.1-1083s1c1
Sequence:CCGGCCAAGCAAGGATGACACGTATCTCGAGATACGTGTCATCCTTGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173576.1-958s1c1
Sequence:CCGGCCAATGAATTTGAGGAAGAATCTCGAGATTCTTCCTCAAATTCATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173576
MKX MISSION shRNA shRNA Plasmid DNA
mohawk homeobox
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173576.2-591s21c1
Sequence:CCGGTAATGCAAGACGTCGGCTTAACTCGAGTTAAGCCGACGTCTTGCATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173576.2-1616s21c1
Sequence:CCGGATTAGCCTGTGTGCATCATTCCTCGAGGAATGATGCACACAGGCTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173576.2-1536s21c1
Sequence:CCGGGTGCCTTGCTTCCCGACAATACTCGAGTATTGTCGGGAAGCAAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173576.2-781s21c1
Sequence:CCGGGTTCACCATCCTGTGATTAAACTCGAGTTTAATCACAGGATGGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173576.1-593s1c1
Sequence:CCGGGCCAGATTTAAGCTGGGCTTTCTCGAGAAAGCCCAGCTTAAATCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173576.1-443s1c1
Sequence:CCGGCCTCAAGCAGTGGCTTTACAACTCGAGTTGTAAAGCCACTGCTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173576.1-1195s1c1
Sequence:CCGGCGTCCCATATAGCAGAAGTAACTCGAGTTACTTCTGCTATATGGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173576.1-1083s1c1
Sequence:CCGGCCAAGCAAGGATGACACGTATCTCGAGATACGTGTCATCCTTGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173576.1-958s1c1
Sequence:CCGGCCAATGAATTTGAGGAAGAATCTCGAGATTCTTCCTCAAATTCATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173576
MKX MISSION shRNA Lentiviral Transduction Particles
mohawk homeobox
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173576.2-591s21c1
Sequence:CCGGTAATGCAAGACGTCGGCTTAACTCGAGTTAAGCCGACGTCTTGCATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173576.2-1616s21c1
Sequence:CCGGATTAGCCTGTGTGCATCATTCCTCGAGGAATGATGCACACAGGCTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173576.2-1536s21c1
Sequence:CCGGGTGCCTTGCTTCCCGACAATACTCGAGTATTGTCGGGAAGCAAGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173576.2-781s21c1
Sequence:CCGGGTTCACCATCCTGTGATTAAACTCGAGTTTAATCACAGGATGGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173576.1-593s1c1
Sequence:CCGGGCCAGATTTAAGCTGGGCTTTCTCGAGAAAGCCCAGCTTAAATCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173576.1-443s1c1
Sequence:CCGGCCTCAAGCAGTGGCTTTACAACTCGAGTTGTAAAGCCACTGCTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173576.1-1195s1c1
Sequence:CCGGCGTCCCATATAGCAGAAGTAACTCGAGTTACTTCTGCTATATGGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173576.1-1083s1c1
Sequence:CCGGCCAAGCAAGGATGACACGTATCTCGAGATACGTGTCATCCTTGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173576.1-958s1c1
Sequence:CCGGCCAATGAATTTGAGGAAGAATCTCGAGATTCTTCCTCAAATTCATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177595
MKX MISSION shRNA Bacterial Glycerol Stock
mohawk homeobox
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177595.4-474s21c1
Sequence:CCGGAGACATGGCGCGTCCTCTTAACTCGAGTTAAGAGGACGCGCCATGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177595.4-575s21c1
Sequence:CCGGCGCTAGTGCAGGTGTCAAATTCTCGAGAATTTGACACCTGCACTAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177595.2-1391s1c1
Sequence:CCGGCCTGAGTTCAACTATCGTAAACTCGAGTTTACGATAGTTGAACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177595.2-619s1c1
Sequence:CCGGCAGATTTAAGTTGGGCCTTAACTCGAGTTAAGGCCCAACTTAAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177595.2-890s1c1
Sequence:CCGGCCGTTACCTTAACGACTCCTTCTCGAGAAGGAGTCGTTAAGGTAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177595.2-1155s1c1
Sequence:CCGGGCCTTAACAAACCTTGCCCAACTCGAGTTGGGCAAGGTTTGTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177595.2-617s1c1
Sequence:CCGGGCCAGATTTAAGTTGGGCCTTCTCGAGAAGGCCCAACTTAAATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177595
MKX MISSION shRNA shRNA Plasmid DNA
mohawk homeobox
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177595.4-474s21c1
Sequence:CCGGAGACATGGCGCGTCCTCTTAACTCGAGTTAAGAGGACGCGCCATGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177595.4-575s21c1
Sequence:CCGGCGCTAGTGCAGGTGTCAAATTCTCGAGAATTTGACACCTGCACTAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177595.2-1391s1c1
Sequence:CCGGCCTGAGTTCAACTATCGTAAACTCGAGTTTACGATAGTTGAACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177595.2-619s1c1
Sequence:CCGGCAGATTTAAGTTGGGCCTTAACTCGAGTTAAGGCCCAACTTAAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177595.2-890s1c1
Sequence:CCGGCCGTTACCTTAACGACTCCTTCTCGAGAAGGAGTCGTTAAGGTAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177595.2-1155s1c1
Sequence:CCGGGCCTTAACAAACCTTGCCCAACTCGAGTTGGGCAAGGTTTGTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177595.2-617s1c1
Sequence:CCGGGCCAGATTTAAGTTGGGCCTTCTCGAGAAGGCCCAACTTAAATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177595
MKX MISSION shRNA Lentiviral Transduction Particles
mohawk homeobox
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177595.4-474s21c1
Sequence:CCGGAGACATGGCGCGTCCTCTTAACTCGAGTTAAGAGGACGCGCCATGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177595.4-575s21c1
Sequence:CCGGCGCTAGTGCAGGTGTCAAATTCTCGAGAATTTGACACCTGCACTAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177595.2-1391s1c1
Sequence:CCGGCCTGAGTTCAACTATCGTAAACTCGAGTTTACGATAGTTGAACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177595.2-619s1c1
Sequence:CCGGCAGATTTAAGTTGGGCCTTAACTCGAGTTAAGGCCCAACTTAAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177595.2-890s1c1
Sequence:CCGGCCGTTACCTTAACGACTCCTTCTCGAGAAGGAGTCGTTAAGGTAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177595.2-1155s1c1
Sequence:CCGGGCCTTAACAAACCTTGCCCAACTCGAGTTGGGCAAGGTTTGTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177595.2-617s1c1
Sequence:CCGGGCCAGATTTAAGTTGGGCCTTCTCGAGAAGGCCCAACTTAAATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)