EMAIL THIS PAGE TO A FRIEND

MLC1

megalencephalic leukoencephalopathy with subcortical cysts 1

57 Gene Product Result for
Synonyms: LVM MLC VL
UniProtKB ID: Q15049, B3KW61, Q5JZ83, Q8TAG4, Q96RP5, Q9UGY8
Gene ID:
Human(23209) Summary: The function of this gene product is unknown; however, homology to other proteins suggests that it may be an integral membrane transporter. Mutations in this gene have been associated with megalencephalic leukoencephalopathy with subcortical cysts, an autosomal recessive neurological disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(170790) megalencephalic leukoencephalopathy with subcortical cysts 1 homolog (human)
Rat(315215) megalencephalic leukoencephalopathy with subcortical cysts 1
Zebrafish(559990) megalencephalic leukoencephalopathy with subcortical cysts 1
fruit fly(43323) Myosin alkali light chain 1
cow(618918) megalencephalic leukoencephalopathy with subcortical cysts 1
domestic cat(101100821) megalencephalic leukoencephalopathy with subcortical cysts 1
dog(607105) megalencephalic leukoencephalopathy with subcortical cysts 1
chicken(417737) megalencephalic leukoencephalopathy with subcortical cysts 1
domestic guinea pig(100721749) megalencephalic leukoencephalopathy with subcortical cysts 1
naked mole-rat(101713212) megalencephalic leukoencephalopathy with subcortical cysts 1
sheep(101114186) megalencephalic leukoencephalopathy with subcortical cysts 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015166 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133241 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133241 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133241 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015166 Rosetta Predictions human pricing
NM_139202 Rosetta Predictions human pricing
NM_001108105 Rosetta Predictions rat pricing
NM_133241 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020062 predicted 1215
2 SASI_Hs01_00020064 predicted 1229
3 SASI_Hs02_00347154 predicted 2124
4 SASI_Hs01_00020065 predicted 1843
5 SASI_Hs01_00020066 predicted 1165
6 SASI_Hs01_00020067 predicted 931
7 SASI_Hs01_00020068 predicted 1944
8 SASI_Hs01_00020069 predicted 989
9 SASI_Hs01_00020070 predicted 2201
10 SASI_Hs01_00020071 predicted 1176
11 SASI_Hs01_00020063 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036556 predicted 856
2 SASI_Hs01_00036558 predicted 876
3 SASI_Hs02_00364230 predicted 1767
4 SASI_Hs01_00036559 predicted 1483
5 SASI_Hs01_00036560 predicted 803
6 SASI_Hs01_00036561 predicted 565
7 SASI_Hs01_00036562 predicted 1586
8 SASI_Hs01_00036563 predicted 628
9 SASI_Hs01_00036564 predicted 1844
10 SASI_Hs01_00036565 predicted 811
11 SASI_Hs01_00036557 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235404 predicted 1704
2 SASI_Rn02_00235405 predicted 1916
3 SASI_Rn02_00235406 predicted 871
4 SASI_Rn02_00235407 predicted 1099
5 SASI_Rn02_00235408 predicted 1052
6 SASI_Rn02_00235409 predicted 839
7 SASI_Rn02_00235410 predicted 1841
8 SASI_Rn02_00235411 predicted 992
9 SASI_Rn02_00235412 predicted 845
10 SASI_Rn02_00235413 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172555 predicted 715
2 SASI_Mm01_00172556 predicted 386
3 SASI_Mm01_00172557 predicted 596
4 SASI_Mm01_00172558 predicted 704
5 SASI_Mm02_00338496 predicted 375
6 SASI_Mm01_00172559 predicted 418
7 SASI_Mm01_00172560 predicted 591
8 SASI_Mm01_00172561 predicted 385
9 SASI_Mm01_00172562 predicted 734
10 SASI_Mm01_00172564 predicted 594
11 SASI_Mm01_00172563 predicted 929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015166
MLC1 MISSION shRNA Bacterial Glycerol Stock
megalencephalic leukoencephalopathy with subcortical cysts 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015166.2-515s1c1
Sequence:CCGGCCCAACTTTCAGATATTGTTTCTCGAGAAACAATATCTGAAAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015166.2-503s1c1
Sequence:CCGGGCCAATGTGATTCCCAACTTTCTCGAGAAAGTTGGGAATCACATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015166.2-592s1c1
Sequence:CCGGCCTGAACCCATCAGCAATAAACTCGAGTTTATTGCTGATGGGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015166.2-561s1c1
Sequence:CCGGCGTGTTTAATTTGGTTTGGATCTCGAGATCCAAACCAAATTAAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015166.2-1048s1c1
Sequence:CCGGCGTGGAGATGTTTAAGGATTACTCGAGTAATCCTTAAACATCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015166.3-2224s21c1
Sequence:CCGGAGTCAGCCCAGTGGGATCTTACTCGAGTAAGATCCCACTGGGCTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015166.3-1313s21c1
Sequence:CCGGCACCTCTCAGTGACGTTCTTTCTCGAGAAAGAACGTCACTGAGAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015166.3-1225s21c1
Sequence:CCGGTTACTCAGTCGTCGAGGTAATCTCGAGATTACCTCGACGACTGAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015166
MLC1 MISSION shRNA shRNA Plasmid DNA
megalencephalic leukoencephalopathy with subcortical cysts 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015166.2-515s1c1
Sequence:CCGGCCCAACTTTCAGATATTGTTTCTCGAGAAACAATATCTGAAAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015166.2-503s1c1
Sequence:CCGGGCCAATGTGATTCCCAACTTTCTCGAGAAAGTTGGGAATCACATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015166.2-592s1c1
Sequence:CCGGCCTGAACCCATCAGCAATAAACTCGAGTTTATTGCTGATGGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015166.2-561s1c1
Sequence:CCGGCGTGTTTAATTTGGTTTGGATCTCGAGATCCAAACCAAATTAAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015166.2-1048s1c1
Sequence:CCGGCGTGGAGATGTTTAAGGATTACTCGAGTAATCCTTAAACATCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015166.3-2224s21c1
Sequence:CCGGAGTCAGCCCAGTGGGATCTTACTCGAGTAAGATCCCACTGGGCTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015166.3-1313s21c1
Sequence:CCGGCACCTCTCAGTGACGTTCTTTCTCGAGAAAGAACGTCACTGAGAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015166.3-1225s21c1
Sequence:CCGGTTACTCAGTCGTCGAGGTAATCTCGAGATTACCTCGACGACTGAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015166
MLC1 MISSION shRNA Lentiviral Transduction Particles
megalencephalic leukoencephalopathy with subcortical cysts 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015166.2-515s1c1
Sequence:CCGGCCCAACTTTCAGATATTGTTTCTCGAGAAACAATATCTGAAAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015166.2-503s1c1
Sequence:CCGGGCCAATGTGATTCCCAACTTTCTCGAGAAAGTTGGGAATCACATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015166.2-592s1c1
Sequence:CCGGCCTGAACCCATCAGCAATAAACTCGAGTTTATTGCTGATGGGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015166.2-561s1c1
Sequence:CCGGCGTGTTTAATTTGGTTTGGATCTCGAGATCCAAACCAAATTAAACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015166.2-1048s1c1
Sequence:CCGGCGTGGAGATGTTTAAGGATTACTCGAGTAATCCTTAAACATCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015166.3-2224s21c1
Sequence:CCGGAGTCAGCCCAGTGGGATCTTACTCGAGTAAGATCCCACTGGGCTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015166.3-1313s21c1
Sequence:CCGGCACCTCTCAGTGACGTTCTTTCTCGAGAAAGAACGTCACTGAGAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015166.3-1225s21c1
Sequence:CCGGTTACTCAGTCGTCGAGGTAATCTCGAGATTACCTCGACGACTGAGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133241
MLC1 MISSION shRNA Bacterial Glycerol Stock
megalencephalic leukoencephalopathy with subcortical cysts 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133241.1-2082s1c1
Sequence:CCGGCCAGAGAATCAAGGAACCTATCTCGAGATAGGTTCCTTGATTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133241.1-1397s1c1
Sequence:CCGGCCAGCCATCAAATCTTATGATCTCGAGATCATAAGATTTGATGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133241.1-871s1c1
Sequence:CCGGCGCTGTGACTACTACGTGTTTCTCGAGAAACACGTAGTAGTCACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133241.1-1080s1c1
Sequence:CCGGCGTTTCCTGCTCGGGTCCTAACTCGAGTTAGGACCCGAGCAGGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133241.1-657s1c1
Sequence:CCGGGCTACAAGACATGGGTGTTCTCTCGAGAGAACACCCATGTCTTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133241
MLC1 MISSION shRNA shRNA Plasmid DNA
megalencephalic leukoencephalopathy with subcortical cysts 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133241.1-2082s1c1
Sequence:CCGGCCAGAGAATCAAGGAACCTATCTCGAGATAGGTTCCTTGATTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133241.1-1397s1c1
Sequence:CCGGCCAGCCATCAAATCTTATGATCTCGAGATCATAAGATTTGATGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133241.1-871s1c1
Sequence:CCGGCGCTGTGACTACTACGTGTTTCTCGAGAAACACGTAGTAGTCACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133241.1-1080s1c1
Sequence:CCGGCGTTTCCTGCTCGGGTCCTAACTCGAGTTAGGACCCGAGCAGGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133241.1-657s1c1
Sequence:CCGGGCTACAAGACATGGGTGTTCTCTCGAGAGAACACCCATGTCTTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133241
MLC1 MISSION shRNA Lentiviral Transduction Particles
megalencephalic leukoencephalopathy with subcortical cysts 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133241.1-2082s1c1
Sequence:CCGGCCAGAGAATCAAGGAACCTATCTCGAGATAGGTTCCTTGATTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133241.1-1397s1c1
Sequence:CCGGCCAGCCATCAAATCTTATGATCTCGAGATCATAAGATTTGATGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133241.1-871s1c1
Sequence:CCGGCGCTGTGACTACTACGTGTTTCTCGAGAAACACGTAGTAGTCACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133241.1-1080s1c1
Sequence:CCGGCGTTTCCTGCTCGGGTCCTAACTCGAGTTAGGACCCGAGCAGGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133241.1-657s1c1
Sequence:CCGGGCTACAAGACATGGGTGTTCTCTCGAGAGAACACCCATGTCTTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)