EMAIL THIS PAGE TO A FRIEND

MLEC

malectin

246 Gene Product Result for
Synonyms: KIAA0152
UniProtKB ID: Q14165
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014730 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014730 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014730 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014730 Rosetta Predictions human pricing
NM_001013983 Rosetta Predictions rat pricing
NM_175403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072480 predicted 1448
2 SASI_Hs01_00072481 predicted 476
3 SASI_Hs01_00072482 predicted 711
4 SASI_Hs01_00072483 predicted 1433
5 SASI_Hs02_00346173 predicted 1446
6 SASI_Hs01_00072485 predicted 895
7 SASI_Hs02_00346174 predicted 1318
8 SASI_Hs01_00072486 predicted 558
9 SASI_Hs01_00072487 predicted 1467
10 SASI_Hs01_00072488 predicted 1305
11 SASI_Hs01_00072484 predicted 394
12 SASI_Hs01_00072489 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031771 predicted 556
2 SASI_Rn01_00031772 predicted 1451
3 SASI_Rn01_00031773 predicted 563
4 SASI_Rn01_00031774 predicted 400
5 SASI_Rn01_00031775 predicted 570
6 SASI_Rn01_00031776 predicted 1459
7 SASI_Rn01_00031777 predicted 869
8 SASI_Rn01_00031778 predicted 494
9 SASI_Rn01_00031779 predicted 509
10 SASI_Rn01_00031780 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064918 predicted 574
2 SASI_Mm01_00064919 predicted 370
3 SASI_Mm01_00064920 predicted 520
4 SASI_Mm01_00064922 predicted 479
5 SASI_Mm02_00346271 predicted 1505
6 SASI_Mm01_00064924 predicted 551
7 SASI_Mm01_00064925 predicted 1499
8 SASI_Mm01_00064926 predicted 495
9 SASI_Mm02_00346272 predicted 271
10 SASI_Mm02_00346273 predicted 1448
11 SASI_Mm01_00064921 predicted 504
12 SASI_Mm01_00064923 predicted 1483
13 SASI_Mm01_00064927 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175403
VALIDATED
MLEC MISSION shRNA Bacterial Glycerol Stock
malectin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.3-416s21c1
Sequence:CCGGCCGGAGGACCAGATCCTATATCTCGAGATATAGGATCTGGTCCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.3-972s21c1
Sequence:CCGGCCTTCGGAGTGTTCATTCCAACTCGAGTTGGAATGAACACTCCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.3-1336s21c1
Sequence:CCGGTCTCCGAGGATCCTCATTATACTCGAGTATAATGAGGATCCTCGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.2-400s1c1
Sequence:CCGGCCTATATCAGACAGAGCGGTACTCGAGTACCGCTCTGTCTGATATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.3-705s21c1
Sequence:CCGGGGAAGCTATACATCGAGTTTGCTCGAGCAAACTCGATGTATAGCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.3-446s21c1
Sequence:CCGGCGGTACAATGAAGAGACCTTTCTCGAGAAAGGTCTCTTCATTGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.2-2568s1c1
Sequence:CCGGCCCTTATTTCTGAATGTGTTTCTCGAGAAACACATTCAGAAATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.2-416s1c1
Sequence:CCGGCGGTACAATGAAGAGACCTTTCTCGAGAAAGGTCTCTTCATTGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.2-601s1c1
Sequence:CCGGCCATGATGAAATCATCCCGATCTCGAGATCGGGATGATTTCATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.2-942s1c1
Sequence:CCGGCCTTCGGAGTGTTCATTCCAACTCGAGTTGGAATGAACACTCCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175403
VALIDATED
MLEC MISSION shRNA shRNA Plasmid DNA
malectin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.3-416s21c1
Sequence:CCGGCCGGAGGACCAGATCCTATATCTCGAGATATAGGATCTGGTCCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.3-972s21c1
Sequence:CCGGCCTTCGGAGTGTTCATTCCAACTCGAGTTGGAATGAACACTCCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.3-1336s21c1
Sequence:CCGGTCTCCGAGGATCCTCATTATACTCGAGTATAATGAGGATCCTCGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.2-400s1c1
Sequence:CCGGCCTATATCAGACAGAGCGGTACTCGAGTACCGCTCTGTCTGATATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.3-705s21c1
Sequence:CCGGGGAAGCTATACATCGAGTTTGCTCGAGCAAACTCGATGTATAGCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.3-446s21c1
Sequence:CCGGCGGTACAATGAAGAGACCTTTCTCGAGAAAGGTCTCTTCATTGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.2-2568s1c1
Sequence:CCGGCCCTTATTTCTGAATGTGTTTCTCGAGAAACACATTCAGAAATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.2-416s1c1
Sequence:CCGGCGGTACAATGAAGAGACCTTTCTCGAGAAAGGTCTCTTCATTGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.2-601s1c1
Sequence:CCGGCCATGATGAAATCATCCCGATCTCGAGATCGGGATGATTTCATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.2-942s1c1
Sequence:CCGGCCTTCGGAGTGTTCATTCCAACTCGAGTTGGAATGAACACTCCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175403
VALIDATED
MLEC MISSION shRNA Lentiviral Transduction Particles
malectin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.3-416s21c1
Sequence:CCGGCCGGAGGACCAGATCCTATATCTCGAGATATAGGATCTGGTCCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.3-972s21c1
Sequence:CCGGCCTTCGGAGTGTTCATTCCAACTCGAGTTGGAATGAACACTCCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.3-1336s21c1
Sequence:CCGGTCTCCGAGGATCCTCATTATACTCGAGTATAATGAGGATCCTCGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.2-400s1c1
Sequence:CCGGCCTATATCAGACAGAGCGGTACTCGAGTACCGCTCTGTCTGATATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.3-705s21c1
Sequence:CCGGGGAAGCTATACATCGAGTTTGCTCGAGCAAACTCGATGTATAGCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.3-446s21c1
Sequence:CCGGCGGTACAATGAAGAGACCTTTCTCGAGAAAGGTCTCTTCATTGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.2-2568s1c1
Sequence:CCGGCCCTTATTTCTGAATGTGTTTCTCGAGAAACACATTCAGAAATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.2-416s1c1
Sequence:CCGGCGGTACAATGAAGAGACCTTTCTCGAGAAAGGTCTCTTCATTGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.2-601s1c1
Sequence:CCGGCCATGATGAAATCATCCCGATCTCGAGATCGGGATGATTTCATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_175403.2-942s1c1
Sequence:CCGGCCTTCGGAGTGTTCATTCCAACTCGAGTTGGAATGAACACTCCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014730
VALIDATED
MLEC MISSION shRNA Bacterial Glycerol Stock
malectin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-595s21c1
Sequence:CCGGCGTGGTGAAGGACTTGGATATCTCGAGATATCCAAGTCCTTCACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-386s21c1
Sequence:CCGGGCCTCAGACTATGGCATGAAACTCGAGTTTCATGCCATAGTCTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-442s1c1
Sequence:CCGGCCTGTATCAAACTGAGCGGTACTCGAGTACCGCTCAGTTTGATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-386s1c1
Sequence:CCGGGCCTCAGACTATGGCATGAAACTCGAGTTTCATGCCATAGTCTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-863s1c1
Sequence:CCGGGAATATGATGAAGGGTCTAATCTCGAGATTAGACCCTTCATCATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-595s1c1
Sequence:CCGGCGTGGTGAAGGACTTGGATATCTCGAGATATCCAAGTCCTTCACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-824s1c1
Sequence:CCGGCCGGGATTGGAGAAGAAAGAACTCGAGTTCTTTCTTCTCCAATCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-863s21c1
Sequence:CCGGGAATATGATGAAGGGTCTAATCTCGAGATTAGACCCTTCATCATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-824s21c1
Sequence:CCGGCCGGGATTGGAGAAGAAAGAACTCGAGTTCTTTCTTCTCCAATCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014730
VALIDATED
MLEC MISSION shRNA shRNA Plasmid DNA
malectin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-595s21c1
Sequence:CCGGCGTGGTGAAGGACTTGGATATCTCGAGATATCCAAGTCCTTCACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-386s21c1
Sequence:CCGGGCCTCAGACTATGGCATGAAACTCGAGTTTCATGCCATAGTCTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-442s1c1
Sequence:CCGGCCTGTATCAAACTGAGCGGTACTCGAGTACCGCTCAGTTTGATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-386s1c1
Sequence:CCGGGCCTCAGACTATGGCATGAAACTCGAGTTTCATGCCATAGTCTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-863s1c1
Sequence:CCGGGAATATGATGAAGGGTCTAATCTCGAGATTAGACCCTTCATCATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-595s1c1
Sequence:CCGGCGTGGTGAAGGACTTGGATATCTCGAGATATCCAAGTCCTTCACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-824s1c1
Sequence:CCGGCCGGGATTGGAGAAGAAAGAACTCGAGTTCTTTCTTCTCCAATCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-863s21c1
Sequence:CCGGGAATATGATGAAGGGTCTAATCTCGAGATTAGACCCTTCATCATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-824s21c1
Sequence:CCGGCCGGGATTGGAGAAGAAAGAACTCGAGTTCTTTCTTCTCCAATCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014730
VALIDATED
MLEC MISSION shRNA Lentiviral Transduction Particles
malectin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-595s21c1
Sequence:CCGGCGTGGTGAAGGACTTGGATATCTCGAGATATCCAAGTCCTTCACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-386s21c1
Sequence:CCGGGCCTCAGACTATGGCATGAAACTCGAGTTTCATGCCATAGTCTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-442s1c1
Sequence:CCGGCCTGTATCAAACTGAGCGGTACTCGAGTACCGCTCAGTTTGATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-386s1c1
Sequence:CCGGGCCTCAGACTATGGCATGAAACTCGAGTTTCATGCCATAGTCTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-863s1c1
Sequence:CCGGGAATATGATGAAGGGTCTAATCTCGAGATTAGACCCTTCATCATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-595s1c1
Sequence:CCGGCGTGGTGAAGGACTTGGATATCTCGAGATATCCAAGTCCTTCACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-824s1c1
Sequence:CCGGCCGGGATTGGAGAAGAAAGAACTCGAGTTCTTTCTTCTCCAATCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-863s21c1
Sequence:CCGGGAATATGATGAAGGGTCTAATCTCGAGATTAGACCCTTCATCATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014730.2-824s21c1
Sequence:CCGGCCGGGATTGGAGAAGAAAGAACTCGAGTTCTTTCTTCTCCAATCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)