EMAIL THIS PAGE TO A FRIEND

MLF1

myeloid leukemia factor 1

85 Gene Product Result for
UniProtKB ID: P58340, E9PEU9, Q2TLE3, Q2TLE5, Q8N8F8, Q96MH1
Gene ID:
Human(4291) Summary: This gene encodes an oncoprotein which is thought to play a role in the phenotypic determination of hemopoetic cells. Translocations between this gene and nucleophosmin have been associated with myelodysplastic syndrome and acute myeloid leukemia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
Mouse(17349) myeloid leukemia factor 1
Rat(310483) myeloid leukemia factor 1
Zebrafish(553527) myeloid leukemia factor 1
domestic cat(101095191) myeloid leukemia factor 1
cow(533379) myeloid leukemia factor 1
dog(477127) myeloid leukemia factor 1
chicken(425019) myeloid leukemia factor 1
sheep(101108357) myeloid leukemia factor 1
domestic guinea pig(100730020) myeloid leukemia factor 1
naked mole-rat(101696287) myeloid leukemia factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022443 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022443 Rosetta Predictions human pricing
NM_001107680 Rosetta Predictions rat pricing
NM_001039543 Rosetta Predictions mouse pricing
NM_010801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036176 predicted 727
2 SASI_Hs01_00036177 predicted 422
3 SASI_Hs01_00036178 predicted 806
4 SASI_Hs01_00036179 predicted 535
5 SASI_Hs01_00036180 predicted 664
6 SASI_Hs01_00036181 predicted 449
7 SASI_Hs01_00036182 predicted 454
8 SASI_Hs01_00036185 predicted 286
9 SASI_Hs02_00355694 predicted 230
10 SASI_Hs02_00355695 predicted 670
11 SASI_Hs01_00036183 predicted 344
12 SASI_Hs01_00036184 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231215 predicted 751
2 SASI_Rn02_00231216 predicted 541
3 SASI_Rn02_00231217 predicted 366
4 SASI_Rn02_00231218 predicted 433
5 SASI_Rn02_00231219 predicted 213
6 SASI_Rn02_00231220 predicted 327
7 SASI_Rn02_00231221 predicted 362
8 SASI_Rn02_00231222 predicted 537
9 SASI_Rn02_00231223 predicted 629
10 SASI_Rn02_00231224 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097115 predicted 619
2 SASI_Mm01_00097116 predicted 594
3 SASI_Mm01_00097117 predicted 586
4 SASI_Mm01_00097119 predicted 651
5 SASI_Mm01_00097120 predicted 722
6 SASI_Mm01_00097121 predicted 656
7 SASI_Mm01_00097122 predicted 719
8 SASI_Mm01_00097124 predicted 701
9 SASI_Mm02_00290125 predicted 596
10 SASI_Mm02_00290126 predicted 673
11 SASI_Mm01_00097118 predicted 717
12 SASI_Mm01_00097123 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056817 predicted 568
2 SASI_Mm01_00056818 predicted 544
3 SASI_Mm01_00056819 predicted 545
4 SASI_Mm01_00056821 predicted 609
5 SASI_Mm01_00056822 predicted 679
6 SASI_Mm01_00056823 predicted 609
7 SASI_Mm01_00056824 predicted 678
8 SASI_Mm01_00056826 predicted 652
9 SASI_Mm02_00319379 predicted 556
10 SASI_Mm02_00319380 predicted 636
11 SASI_Mm01_00056820 predicted 724
12 SASI_Mm01_00056825 predicted 721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022443
VALIDATED
MLF1 MISSION shRNA Bacterial Glycerol Stock
myeloid leukemia factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022443.2-917s1c1
Sequence:CCGGGCCATGCATTTGATTTGTTTACTCGAGTAAACAAATCAAATGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022443.2-830s1c1
Sequence:CCGGGCCATTGAACATGGAAGGAGACTCGAGTCTCCTTCCATGTTCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022443.2-735s1c1
Sequence:CCGGGACACAATCTAGGAAACACTACTCGAGTAGTGTTTCCTAGATTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022443.2-815s1c1
Sequence:CCGGCCTCAACAAAGTCCAGCCATTCTCGAGAATGGCTGGACTTTGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022443.2-159s1c1
Sequence:CCGGCCATTCTTGCACACCGAGAAACTCGAGTTTCTCGGTGTGCAAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_022443.3-190s21c1
Sequence:CCGGCCATTCTTGCACACCGAGAAACTCGAGTTTCTCGGTGTGCAAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_022443.3-948s21c1
Sequence:CCGGGCCATGCATTTGATTTGTTTACTCGAGTAAACAAATCAAATGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_022443.3-276s21c1
Sequence:CCGGGGTAGAGGGAGAGCTCATAATCTCGAGATTATGAGCTCTCCCTCTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022443.3-766s21c1
Sequence:CCGGGACACAATCTAGGAAACACTACTCGAGTAGTGTTTCCTAGATTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022443.3-621s21c1
Sequence:CCGGGACCGAGCTCATGTCATTAAACTCGAGTTTAATGACATGAGCTCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022443
VALIDATED
MLF1 MISSION shRNA shRNA Plasmid DNA
myeloid leukemia factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022443.2-917s1c1
Sequence:CCGGGCCATGCATTTGATTTGTTTACTCGAGTAAACAAATCAAATGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022443.2-830s1c1
Sequence:CCGGGCCATTGAACATGGAAGGAGACTCGAGTCTCCTTCCATGTTCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022443.2-735s1c1
Sequence:CCGGGACACAATCTAGGAAACACTACTCGAGTAGTGTTTCCTAGATTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022443.2-815s1c1
Sequence:CCGGCCTCAACAAAGTCCAGCCATTCTCGAGAATGGCTGGACTTTGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022443.2-159s1c1
Sequence:CCGGCCATTCTTGCACACCGAGAAACTCGAGTTTCTCGGTGTGCAAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_022443.3-190s21c1
Sequence:CCGGCCATTCTTGCACACCGAGAAACTCGAGTTTCTCGGTGTGCAAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_022443.3-948s21c1
Sequence:CCGGGCCATGCATTTGATTTGTTTACTCGAGTAAACAAATCAAATGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_022443.3-276s21c1
Sequence:CCGGGGTAGAGGGAGAGCTCATAATCTCGAGATTATGAGCTCTCCCTCTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022443.3-766s21c1
Sequence:CCGGGACACAATCTAGGAAACACTACTCGAGTAGTGTTTCCTAGATTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022443.3-621s21c1
Sequence:CCGGGACCGAGCTCATGTCATTAAACTCGAGTTTAATGACATGAGCTCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022443
VALIDATED
MLF1 MISSION shRNA Lentiviral Transduction Particles
myeloid leukemia factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022443.2-917s1c1
Sequence:CCGGGCCATGCATTTGATTTGTTTACTCGAGTAAACAAATCAAATGCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022443.2-830s1c1
Sequence:CCGGGCCATTGAACATGGAAGGAGACTCGAGTCTCCTTCCATGTTCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022443.2-735s1c1
Sequence:CCGGGACACAATCTAGGAAACACTACTCGAGTAGTGTTTCCTAGATTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022443.2-815s1c1
Sequence:CCGGCCTCAACAAAGTCCAGCCATTCTCGAGAATGGCTGGACTTTGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022443.2-159s1c1
Sequence:CCGGCCATTCTTGCACACCGAGAAACTCGAGTTTCTCGGTGTGCAAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_022443.3-190s21c1
Sequence:CCGGCCATTCTTGCACACCGAGAAACTCGAGTTTCTCGGTGTGCAAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_022443.3-948s21c1
Sequence:CCGGGCCATGCATTTGATTTGTTTACTCGAGTAAACAAATCAAATGCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_022443.3-276s21c1
Sequence:CCGGGGTAGAGGGAGAGCTCATAATCTCGAGATTATGAGCTCTCCCTCTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022443.3-766s21c1
Sequence:CCGGGACACAATCTAGGAAACACTACTCGAGTAGTGTTTCCTAGATTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022443.3-621s21c1
Sequence:CCGGGACCGAGCTCATGTCATTAAACTCGAGTTTAATGACATGAGCTCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010801
VALIDATED
MLF1 MISSION shRNA Bacterial Glycerol Stock
myeloid leukemia factor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010801.1-138s1c1
Sequence:CCGGGCGCAACATGATGAGAAGTTTCTCGAGAAACTTCTCATCATGTTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010801.1-600s1c1
Sequence:CCGGCAACCAAGAGTTCATCAATATCTCGAGATATTGATGAACTCTTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191041    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010801.1-870s1c1
Sequence:CCGGCCTGCATTTCATTTGTTTAGTCTCGAGACTAAACAAATGAAATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010801.1-598s1c1
Sequence:CCGGGTCAACCAAGAGTTCATCAATCTCGAGATTGATGAACTCTTGGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010801.3-197s21c1
Sequence:CCGGGCGCAACATGATGAGAAGTTTCTCGAGAAACTTCTCATCATGTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010801.3-287s21c1
Sequence:CCGGACGTGATGATGGCGAAGATTCCTCGAGGAATCTTCGCCATCATCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010801.3-657s21c1
Sequence:CCGGGTCAACCAAGAGTTCATCAATCTCGAGATTGATGAACTCTTGGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010801.3-846s21c1
Sequence:CCGGGAGAGTGGAAGAAGATCAAACCTCGAGGTTTGATCTTCTTCCACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010801
VALIDATED
MLF1 MISSION shRNA shRNA Plasmid DNA
myeloid leukemia factor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010801.1-138s1c1
Sequence:CCGGGCGCAACATGATGAGAAGTTTCTCGAGAAACTTCTCATCATGTTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010801.1-600s1c1
Sequence:CCGGCAACCAAGAGTTCATCAATATCTCGAGATATTGATGAACTCTTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191041    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010801.1-870s1c1
Sequence:CCGGCCTGCATTTCATTTGTTTAGTCTCGAGACTAAACAAATGAAATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010801.1-598s1c1
Sequence:CCGGGTCAACCAAGAGTTCATCAATCTCGAGATTGATGAACTCTTGGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010801.3-197s21c1
Sequence:CCGGGCGCAACATGATGAGAAGTTTCTCGAGAAACTTCTCATCATGTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010801.3-287s21c1
Sequence:CCGGACGTGATGATGGCGAAGATTCCTCGAGGAATCTTCGCCATCATCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010801.3-657s21c1
Sequence:CCGGGTCAACCAAGAGTTCATCAATCTCGAGATTGATGAACTCTTGGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010801.3-846s21c1
Sequence:CCGGGAGAGTGGAAGAAGATCAAACCTCGAGGTTTGATCTTCTTCCACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010801
VALIDATED
MLF1 MISSION shRNA Lentiviral Transduction Particles
myeloid leukemia factor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010801.1-138s1c1
Sequence:CCGGGCGCAACATGATGAGAAGTTTCTCGAGAAACTTCTCATCATGTTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010801.1-600s1c1
Sequence:CCGGCAACCAAGAGTTCATCAATATCTCGAGATATTGATGAACTCTTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191041    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010801.1-870s1c1
Sequence:CCGGCCTGCATTTCATTTGTTTAGTCTCGAGACTAAACAAATGAAATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010801.1-598s1c1
Sequence:CCGGGTCAACCAAGAGTTCATCAATCTCGAGATTGATGAACTCTTGGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010801.3-197s21c1
Sequence:CCGGGCGCAACATGATGAGAAGTTTCTCGAGAAACTTCTCATCATGTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010801.3-287s21c1
Sequence:CCGGACGTGATGATGGCGAAGATTCCTCGAGGAATCTTCGCCATCATCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010801.3-657s21c1
Sequence:CCGGGTCAACCAAGAGTTCATCAATCTCGAGATTGATGAACTCTTGGTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010801.3-846s21c1
Sequence:CCGGGAGAGTGGAAGAAGATCAAACCTCGAGGTTTGATCTTCTTCCACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)